chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_002249.6(KCNN3):​c.203_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln68_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

Frequency

Genomes: 𝑓 0.00018 ( 0 hom., cov: 0)
Exomes 𝑓: 0.000046 ( 0 hom. )
Failed GnomAD Quality Control

Consequence

KCNN3
NM_002249.6 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 2.12

Publications

18 publications found
Variant links:
Genes affected
KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
KCNN3 Gene-Disease associations (from GenCC):
  • Zimmermann-Laband syndrome 3
    Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
  • Zimmermann-Laband syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • schizophrenia
    Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
KCNN3NM_002249.6 linkc.203_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC p.Gln68_Gln80dup conservative_inframe_insertion Exon 1 of 8 ENST00000271915.9 NP_002240.3 Q9UGI6-1
KCNN3NM_001204087.2 linkc.203_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC p.Gln68_Gln80dup conservative_inframe_insertion Exon 1 of 9 NP_001191016.1 Q9UGI6A0A087WYJ0

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
KCNN3ENST00000271915.9 linkc.203_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC p.Gln68_Gln80dup conservative_inframe_insertion Exon 1 of 8 1 NM_002249.6 ENSP00000271915.3 Q9UGI6-1

Frequencies

GnomAD3 genomes
AF:
0.000177
AC:
25
AN:
141288
Hom.:
0
Cov.:
0
show subpopulations
Gnomad AFR
AF:
0.000451
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.000648
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.0000767
Gnomad OTH
AF:
0.00
GnomAD4 exome
Data not reliable, filtered out with message: AS_VQSR
AF:
0.0000461
AC:
63
AN:
1365124
Hom.:
0
Cov.:
112
AF XY:
0.0000370
AC XY:
25
AN XY:
674886
show subpopulations
⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
African (AFR)
AF:
0.000225
AC:
7
AN:
31108
American (AMR)
AF:
0.000113
AC:
4
AN:
35514
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
24960
East Asian (EAS)
AF:
0.000141
AC:
5
AN:
35568
South Asian (SAS)
AF:
0.0000762
AC:
6
AN:
78748
European-Finnish (FIN)
AF:
0.0000217
AC:
1
AN:
46140
Middle Eastern (MID)
AF:
0.000226
AC:
1
AN:
4434
European-Non Finnish (NFE)
AF:
0.0000352
AC:
37
AN:
1051848
Other (OTH)
AF:
0.0000352
AC:
2
AN:
56804
⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.309
Heterozygous variant carriers
0
6
12
17
23
29
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
AF:
0.000177
AC:
25
AN:
141390
Hom.:
0
Cov.:
0
AF XY:
0.000176
AC XY:
12
AN XY:
68016
show subpopulations
African (AFR)
AF:
0.000449
AC:
17
AN:
37840
American (AMR)
AF:
0.00
AC:
0
AN:
14158
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3376
East Asian (EAS)
AF:
0.000650
AC:
3
AN:
4614
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4042
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
9120
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
282
European-Non Finnish (NFE)
AF:
0.0000767
AC:
5
AN:
65186
Other (OTH)
AF:
0.00
AC:
0
AN:
1902
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.467
Heterozygous variant carriers
0
1
2
4
5
6
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.1
Mutation Taster
=75/25
polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199; API