chr1-209432291-TAGCAGCAGCAGCAGCAGCAGCAGCAGC-T
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The ENST00000366437.8(MIR205HG):n.653_679delGCAGCAGCAGCAGCAGCAGCAGCAGCA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000173 in 1,333,130 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000366437.8 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt | 
|---|---|---|---|---|---|---|---|---|
| MIR205HG | NR_145433.1  | n.599_625delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 3 of 3 | ||||
| MIR205HG | NR_145434.1  | n.734_760delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 5 of 5 | ||||
| MIR205HG | NR_145435.1  | n.682_708delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 | 
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt | 
|---|---|---|---|---|---|---|---|---|---|---|
| MIR205HG | ENST00000366437.8  | n.653_679delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 | 3 | |||||
| MIR205HG | ENST00000429156.7  | n.764_790delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 5 of 5 | 3 | |||||
| MIR205HG | ENST00000431096.7  | n.685_711delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 | 3 | 
Frequencies
GnomAD3 genomes   AF:  0.0000535  AC: 8AN: 149472Hom.:  0  Cov.: 0 show subpopulations 
GnomAD4 exome  AF:  0.0000118  AC: 14AN: 1183548Hom.:  0   AF XY:  0.0000171  AC XY: 10AN XY: 585122 show subpopulations 
Age Distribution
GnomAD4 genome   AF:  0.0000602  AC: 9AN: 149582Hom.:  0  Cov.: 0 AF XY:  0.0000685  AC XY: 5AN XY: 72968 show subpopulations 
Age Distribution
ClinVar
Not reported inComputational scores
Source: 
Splicing
 Find out detailed SpliceAI scores and Pangolin per-transcript scores at