chr1-209432291-TAGCAGCAGCAGCAGCAGCAGCAGCAGC-T

Variant names:

• chr1-209432291-TAGCAGCAGCAGCAGCAGCAGCAGCAGC-T
• rs3842530
• ENST00000366437.8:n.653_679delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000366437.8(MIR205HG):​n.653_679delGCAGCAGCAGCAGCAGCAGCAGCAGCA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000173 in 1,333,130 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000060 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000012 (0 hom.)
• Consequence: MIR205HG ENST00000366437.8 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.825
• Publications: 10 publications found

Genes affected

MIR205HG (HGNC:43562): (MIR205 host gene)

MIR205 (HGNC:31583): (microRNA 205) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000366437.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MIR205HG	NR_145433.1		n.599_625delGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 3 of 3
	MIR205HG	NR_145434.1		n.734_760delGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 5 of 5
	MIR205HG	NR_145435.1		n.682_708delGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 4 of 4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MIR205HG	ENST00000366437.8	TSL:3	n.653_679delGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 4 of 4
	MIR205HG	ENST00000429156.7	TSL:3	n.764_790delGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 5 of 5
	MIR205HG	ENST00000431096.7	TSL:3	n.685_711delGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 4 of 4

Frequencies

GnomAD3 genomes AF: 0.0000535 AC: 8 AN: 149472 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000149

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000194

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000118 AC: 14 AN: 1183548 Hom.: 0 AF XY: 0.0000171 AC XY: 10 AN XY: 585122

African (AFR) AF: 0.000270 AC: 7 AN: 25904

American (AMR) AF: 0.00 AC: 0 AN: 34060

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16278

East Asian (EAS) AF: 0.00 AC: 0 AN: 16402

South Asian (SAS) AF: 0.0000123 AC: 1 AN: 81278

European-Finnish (FIN) AF: 0.0000333 AC: 1 AN: 30016

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4160

European-Non Finnish (NFE) AF: 0.00000214 AC: 2 AN: 932548

Other (OTH) AF: 0.0000699 AC: 3 AN: 42902

GnomAD4 genome AF: 0.0000602 AC: 9 AN: 149582 Hom.: 0 Cov.: 0 AF XY: 0.0000685 AC XY: 5 AN XY: 72968

African (AFR) AF: 0.000174 AC: 7 AN: 40278

American (AMR) AF: 0.00 AC: 0 AN: 15046

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 5034

South Asian (SAS) AF: 0.00 AC: 0 AN: 4630

European-Finnish (FIN) AF: 0.000194 AC: 2 AN: 10334

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67532

Other (OTH) AF: 0.00 AC: 0 AN: 2080

Alfa AF: 0.00 Hom.: 2701

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.82

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3842530; hg19: chr1-209605636;