chr10-43114744-TCCCTGCGGGGCAGGGAAGATC-T

Variant names:

• chr10-43114744-TCCCTGCGGGGCAGGGAAGATC-T
• rs753686672
• NM_020975.6:c.2136+15_2136+35delGGGGCAGGGAAGATCCCCTGC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP6 BS1

The ENST00000355710.8(RET):​c.2136+9_2136+29delCCCTGCGGGGCAGGGAAGATC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000162 in 1,605,418 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000017 (0 hom.)
• Consequence: RET ENST00000355710.8 intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:1
• Conservation: PhyloP100: 1.14
• Publications: 1 publications found

Genes affected

RET (HGNC:9967): (ret proto-oncogene) This gene encodes a transmembrane receptor and member of the tyrosine protein kinase family of proteins. Binding of ligands such as GDNF (glial cell-line derived neurotrophic factor) and other related proteins to the encoded receptor stimulates receptor dimerization and activation of downstream signaling pathways that play a role in cell differentiation, growth, migration and survival. The encoded receptor is important in development of the nervous system, and the development of organs and tissues derived from the neural crest. This proto-oncogene can undergo oncogenic activation through both cytogenetic rearrangement and activating point mutations. Mutations in this gene are associated with Hirschsprung disease and central hypoventilation syndrome and have been identified in patients with renal agenesis. [provided by RefSeq, Sep 2017]

RET Gene-Disease associations (from GenCC):

• familial medullary thyroid carcinoma

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• multiple endocrine neoplasia type 2A

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P
• multiple endocrine neoplasia type 2B

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen
• pheochromocytoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• Hirschsprung disease, susceptibility to, 1

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• Haddad syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Hirschsprung disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• renal agenesis, unilateral

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• bilateral renal agenesis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• renal agenesis

  Inheritance: AR Classification: LIMITED Submitted by: G2P

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP6: Variant 10-43114744-TCCCTGCGGGGCAGGGAAGATC-T is Benign according to our data. Variant chr10-43114744-TCCCTGCGGGGCAGGGAAGATC-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 219590.
• BS1: Variant frequency is greater than expected in population eas. GnomAdExome4 allele frequency = 0.0000165 (24/1453956) while in subpopulation EAS AF = 0.000354 (14/39526). AF 95% confidence interval is 0.000214. There are 0 homozygotes in GnomAdExome4. There are 10 alleles in the male GnomAdExome4 subpopulation. This position passed quality control check.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000355710.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RET	NM_020975.6	MANE Select	c.2136+15_2136+35delGGGGCAGGGAAGATCCCCTGC		intron	N/A	NP_066124.1
	RET	NM_001406743.1		c.2136+15_2136+35delGGGGCAGGGAAGATCCCCTGC		intron	N/A	NP_001393672.1
	RET	NM_001406744.1		c.2136+15_2136+35delGGGGCAGGGAAGATCCCCTGC		intron	N/A	NP_001393673.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RET	ENST00000355710.8	TSL:5 MANE Select	c.2136+9_2136+29delCCCTGCGGGGCAGGGAAGATC		intron	N/A	ENSP00000347942.3
	RET	ENST00000340058.6	TSL:1	c.2136+9_2136+29delCCCTGCGGGGCAGGGAAGATC		intron	N/A	ENSP00000344798.4
	RET	ENST00000713926.1		c.1872+9_1872+29delCCCTGCGGGGCAGGGAAGATC		intron	N/A	ENSP00000519223.1

Frequencies

GnomAD3 genomes AF: 0.0000132 AC: 2 AN: 151462 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000196

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000423 AC: 10 AN: 236614 AF XY: 0.0000310

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000509

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000932

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000165 AC: 24 AN: 1453956 Hom.: 0 AF XY: 0.0000138 AC XY: 10 AN XY: 723208

African (AFR) AF: 0.00 AC: 0 AN: 33376

American (AMR) AF: 0.00 AC: 0 AN: 44354

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26024

East Asian (EAS) AF: 0.000354 AC: 14 AN: 39526

South Asian (SAS) AF: 0.00 AC: 0 AN: 85772

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 48416

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5758

European-Non Finnish (NFE) AF: 0.00000900 AC: 10 AN: 1110520

Other (OTH) AF: 0.00 AC: 0 AN: 60210

GnomAD4 genome AF: 0.0000132 AC: 2 AN: 151462 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 73966

African (AFR) AF: 0.00 AC: 0 AN: 41168

American (AMR) AF: 0.00 AC: 0 AN: 15252

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3460

East Asian (EAS) AF: 0.000196 AC: 1 AN: 5108

South Asian (SAS) AF: 0.00 AC: 0 AN: 4756

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10564

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 67848

Other (OTH) AF: 0.00 AC: 0 AN: 2084

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000189

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	-	1	Multiple endocrine neoplasia, type 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs753686672; hg19: chr10-43610192;