chr11-108252010-AAGTGCCTCCAATTCTTCACAGGTAATTTAAGTTCATTAGCATGCTGCTGTTTTTTTTGTTTGTTTTATCAGGCTCTCTCCACTTATTTGATGCCAGATGGCTTTATTTTAT-A
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000051.4(ATM):c.1783_1802+91del(p.Val595GlufsTer2426) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. V595V) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000051.4 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- hereditary breast carcinomaInheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics, ClinGen
- ataxia telangiectasiaInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P, ClinGen, Laboratory for Molecular Medicine, Orphanet
- hereditary nonpolyposis colon cancerInheritance: AD Classification: MODERATE, LIMITED Submitted by: ClinGen, Ambry Genetics
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- familial ovarian cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
- gastric carcinomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ATM | NM_000051.4 | c.1783_1802+91del | p.Val595GlufsTer2426 | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 11 of 63 | ENST00000675843.1 | NP_000042.3 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ATM | ENST00000675843.1 | c.1782_1802+90del | p.Glu594_Ser601delinsAsp | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | Exon 11 of 63 | NM_000051.4 | ENSP00000501606.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Pathogenic:2
This variant deletes 111 nucleotides in exon 11/intron 11 splice junction of the ATM gene, removing the splice donor site. Aberrant splicing is expected to result in a premature translation stop signal and an absent or non-functional protein product, but this has not been tested experimentally. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of ATM function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Likely Pathogenic. -
The c.1783_1802+91del111 intronic variant begins 91 nucleotides after coding exon 10 in the ATM gene. This variant results from a deletion of 111 nucleotides at positions c.1783 to c.1802+91. This deletion encompasses the native splice donor site. This variant was identified in 1/177 individuals with pancreatic ductal adenocarcinoma undergoing multi-gene panel testing (Cremin C et al. Cancer Med, 2020 06;9:4004-4013). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In silico splice site analysis predicts that this alteration will weaken the native splice donor site; however, direct evidence is insufficient at this time (Ambry internal data). Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic. -
Ataxia-telangiectasia syndrome Pathogenic:1
This variant results in the deletion of part of exon 11 (c.1783_1802+91del) of the ATM gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in ATM are known to be pathogenic (PMID: 23807571, 25614872). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with pancreatic ductal adenocarcinoma (PMID: 32255556). ClinVar contains an entry for this variant (Variation ID: 407614). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -
ATM-related cancer predisposition Pathogenic:1
- -
not provided Pathogenic:1
Splice variant involving the canonical site, predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 32255556) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at