chr11-108335940-ATTAACTATCTGTACTTATAAG-A
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2PM4PP3PP5
The NM_000051.4(ATM):c.8248_8268delTTAACTATCTGTACTTATAAG(p.Leu2750_Lys2756del) variant causes a conservative inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000685 in 1,459,608 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_000051.4 conservative_inframe_deletion, splice_region
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ATM | NM_000051.4 | c.8248_8268delTTAACTATCTGTACTTATAAG | p.Leu2750_Lys2756del | conservative_inframe_deletion, splice_region_variant | Exon 56 of 63 | ENST00000675843.1 | NP_000042.3 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 exomes AF: 0.00000398 AC: 1AN: 251022Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 135656
GnomAD4 exome AF: 6.85e-7 AC: 1AN: 1459608Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 726306
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.8248_8268del21 variant (also known as p.L2750_K2756del) is located in coding exon 55 of the ATM gene. This variant results from an in-frame TTAACTATCTGTACTTATAAG deletion at nucleotide positions 8248 to 8268. This leads to the in-frame deletion of seven residues (LTICTYK) from codon 2750 to codon 2756. This nucleotide region is well conserved in available vertebrate species. This deletion includes the last base pair of coding exon 55, which makes it likely to have some effect on normal mRNA splicing. In silico splice site analysis predicts that this alteration will weaken the native splice donor site.. RNA studies have demonstrated that this alteration results in an abnormal splicing in the set of samples tested (Ambry internal data). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -
Familial cancer of breast Pathogenic:1
This variant is considered likely pathogenic. mRNA analysis has demonstrated abnormal mRNA splicing occurs [Myriad internal data]. -
Ataxia-telangiectasia syndrome Uncertain:1
This variant, c.8248_8268del, results in the deletion of 7 amino acid(s) of the ATM protein (p.Leu2750_Lys2756del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs771146489, gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ATM-related conditions. ClinVar contains an entry for this variant (Variation ID: 422777). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not provided Uncertain:1
This in-frame deletion of 21 nucleotides in ATM is denoted c.8248_8268del21 at the cDNA level and p.Leu2750_Lys2756del (L2750_K2756del) at the protein level. The normal sequence, with the bases that are deleted in brackets, is GAAA[del21]gtaa. This variant has not, to our knowledge, been published in the literature as pathogenic or benign. ATM Leu2750_Lys2756del was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, suggesting it is not a common benign variant in these populations. The deleted residues are either conserved, conserved by class, or conserved through mammals, and are located in the kinase domain (Stracker 2013). Multiple splicing models predict that this variant may destroy the natural splice donor site for intron 56 and lead to abnormal splicing. However, in the absence of RNA or functional studies, the actual effect of this variant is unknown. Since in-frame deletions may or may not inhibit proper protein functioning, the clinical significance of this finding remains unclear at this time and we consider ATM Leu2750_Lys2756del to be a variant of uncertain significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at