chr11-119278559-CTGAACCCATCGTGGTAGATCCGTTTGATCCTAGAGGGAGTGGCAGCCTGTTGAGGCAAGGAGCAGAGGGAGCTCCCTCCCCAAATTATGATGATGATGATGA-C
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3
The NM_005188.4(CBL):c.1283_1384del(p.Pro428_Glu461del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. P428P) has been classified as Likely benign.
Frequency
Consequence
NM_005188.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- CBL-related disorderInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, PanelApp Australia, Genomics England PanelApp
- juvenile myelomonocytic leukemiaInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Noonan syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| CBL | NM_005188.4 | c.1283_1384del | p.Pro428_Glu461del | disruptive_inframe_deletion | Exon 9 of 16 | ENST00000264033.6 | NP_005179.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| CBL | ENST00000264033.6 | c.1283_1384del | p.Pro428_Glu461del | disruptive_inframe_deletion | Exon 9 of 16 | 1 | NM_005188.4 | ENSP00000264033.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not specified Uncertain:1
Variant classified as Uncertain Significance - Favor Pathogenic. The p.Pro428_Gl u461del variant in CBL has not been previously reported in individuals with a RA Sopathy. This variant is a deletion of 33 amino acids at position 428 and is not predicted to alter the protein reading-frame. The region containing the 33 dele ted amino acids is conserved in mammals and across evolutionarily distant specie s, and while this is likely to affect the protein, the impact to protein functio n cannot be fully determined. In addition, other variants in this region have be en reported in individuals with Noonan-like features and/or JMML (Strullu 2013, Martinelli 2010, LMM unpublished data). In summary, while there is some suspicio n for a pathogenic role, the clinical significance of the p.Pro428_Glu461del var iant is uncertain. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at