chr11-119278559-CTGAACCCATCGTGGTAGATCCGTTTGATCCTAGAGGGAGTGGCAGCCTGTTGAGGCAAGGAGCAGAGGGAGCTCCCTCCCCAAATTATGATGATGATGATGA-C
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3
The NM_005188.4(CBL):c.1283_1384del(p.Pro428_Glu461del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
CBL
NM_005188.4 disruptive_inframe_deletion
NM_005188.4 disruptive_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.60
Genes affected
CBL (HGNC:1541): (Cbl proto-oncogene) This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 5 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_005188.4.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CBL | NM_005188.4 | c.1283_1384del | p.Pro428_Glu461del | disruptive_inframe_deletion | 9/16 | ENST00000264033.6 | NP_005179.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CBL | ENST00000264033.6 | c.1283_1384del | p.Pro428_Glu461del | disruptive_inframe_deletion | 9/16 | 1 | NM_005188.4 | ENSP00000264033.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not specified Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine | May 08, 2015 | Variant classified as Uncertain Significance - Favor Pathogenic. The p.Pro428_Gl u461del variant in CBL has not been previously reported in individuals with a RA Sopathy. This variant is a deletion of 33 amino acids at position 428 and is not predicted to alter the protein reading-frame. The region containing the 33 dele ted amino acids is conserved in mammals and across evolutionarily distant specie s, and while this is likely to affect the protein, the impact to protein functio n cannot be fully determined. In addition, other variants in this region have be en reported in individuals with Noonan-like features and/or JMML (Strullu 2013, Martinelli 2010, LMM unpublished data). In summary, while there is some suspicio n for a pathogenic role, the clinical significance of the p.Pro428_Glu461del var iant is uncertain. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at