chr11-17448563-T-TGAGCTGATTGGTGTCGATGGCAACCAGATTA
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000352.6(ABCC8):c.1254_1284dupTAATCTGGTTGCCATCGACACCAATCAGCTC(p.Met429fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000112 in 1,614,046 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. L428L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000352.6 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- hyperinsulinemic hypoglycemia, familial, 1Inheritance: AD, AR, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics, Illumina
- diabetes mellitus, permanent neonatal 3Inheritance: AR, SD, AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- familial hyperinsulinismInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- diabetes mellitusInheritance: SD Classification: DEFINITIVE Submitted by: Ambry Genetics
- monogenic diabetesInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- diabetes mellitus, noninsulin-dependentInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- diabetes mellitus, transient neonatal, 2Inheritance: AD, Unknown Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- hypoglycemia, leucine-inducedInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- transient neonatal diabetes mellitusInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- permanent neonatal diabetes mellitusInheritance: AR, AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- pulmonary arterial hypertensionInheritance: AD Classification: MODERATE Submitted by: ClinGen
- autosomal dominant hyperinsulinism due to SUR1 deficiencyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- DEND syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- diazoxide-resistant focal hyperinsulinism due to SUR1 deficiencyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- maturity-onset diabetes of the youngInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive hyperinsulinism due to SUR1 deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- type 2 diabetes mellitusInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000352.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ABCC8 | MANE Select | c.1254_1284dupTAATCTGGTTGCCATCGACACCAATCAGCTC | p.Met429fs | frameshift stop_gained | Exon 8 of 39 | NP_000343.2 | Q09428-1 | ||
| ABCC8 | c.1254_1284dupTAATCTGGTTGCCATCGACACCAATCAGCTC | p.Met429fs | frameshift stop_gained | Exon 8 of 39 | NP_001338224.1 | A0A2R8Y4V0 | |||
| ABCC8 | c.1254_1284dupTAATCTGGTTGCCATCGACACCAATCAGCTC | p.Met429fs | frameshift stop_gained | Exon 8 of 39 | NP_001274103.1 | Q09428-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ABCC8 | TSL:1 MANE Select | c.1254_1284dupTAATCTGGTTGCCATCGACACCAATCAGCTC | p.Met429fs | frameshift stop_gained | Exon 8 of 39 | ENSP00000374467.4 | Q09428-1 | ||
| ABCC8 | c.1254_1284dupTAATCTGGTTGCCATCGACACCAATCAGCTC | p.Met429fs | frameshift stop_gained | Exon 8 of 39 | ENSP00000494321.1 | A0A2R8Y4V0 | |||
| ABCC8 | TSL:5 | c.1254_1284dupTAATCTGGTTGCCATCGACACCAATCAGCTC | p.Met429fs | frameshift stop_gained | Exon 8 of 39 | ENSP00000303960.4 | Q09428-2 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152164Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000159 AC: 4AN: 251476 AF XY: 0.0000147 show subpopulations
GnomAD4 exome AF: 0.0000116 AC: 17AN: 1461882Hom.: 0 Cov.: 31 AF XY: 0.0000138 AC XY: 10AN XY: 727244 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152164Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74316 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at