chr11-22262189-AGTTTGTAAATTTTTACTCATCCT-A
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_213599.3(ANO5):c.1693_1715delTTTGTAAATTTTTACTCATCCTG(p.Phe565LeufsTer7) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. F565F) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_213599.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive limb-girdle muscular dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- gnathodiaphyseal dysplasiaInheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P
- autosomal recessive limb-girdle muscular dystrophy type 2LInheritance: AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P
- Miyoshi muscular dystrophy 3Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_213599.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ANO5 | NM_213599.3 | MANE Select | c.1693_1715delTTTGTAAATTTTTACTCATCCTG | p.Phe565LeufsTer7 | frameshift | Exon 16 of 22 | NP_998764.1 | ||
| ANO5 | NM_001142649.2 | c.1690_1712delTTTGTAAATTTTTACTCATCCTG | p.Phe564LeufsTer7 | frameshift | Exon 16 of 22 | NP_001136121.1 | |||
| ANO5 | NM_001410963.1 | c.1651_1673delTTTGTAAATTTTTACTCATCCTG | p.Phe551LeufsTer7 | frameshift | Exon 15 of 21 | NP_001397892.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ANO5 | ENST00000324559.9 | TSL:1 MANE Select | c.1693_1715delTTTGTAAATTTTTACTCATCCTG | p.Phe565LeufsTer7 | frameshift | Exon 16 of 22 | ENSP00000315371.9 | ||
| ANO5 | ENST00000682341.1 | c.1651_1673delTTTGTAAATTTTTACTCATCCTG | p.Phe551LeufsTer7 | frameshift | Exon 15 of 21 | ENSP00000508251.1 | |||
| ANO5 | ENST00000684663.1 | c.1648_1670delTTTGTAAATTTTTACTCATCCTG | p.Phe550LeufsTer7 | frameshift | Exon 15 of 21 | ENSP00000508009.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Miyoshi muscular dystrophy 3 Uncertain:1
Gnathodiaphyseal dysplasia Uncertain:1
Autosomal recessive limb-girdle muscular dystrophy type 2L Uncertain:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at