chr11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000256.3(MYBPC3):c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG(p.Pro892fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 30)
Consequence
MYBPC3
NM_000256.3 frameshift
NM_000256.3 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.0100
Genes affected
MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT is Pathogenic according to our data. Variant chr11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT is described in ClinVar as [Pathogenic]. Clinvar id is 454318.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MYBPC3 | NM_000256.3 | c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG | p.Pro892fs | frameshift_variant | 26/35 | ENST00000545968.6 | NP_000247.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MYBPC3 | ENST00000545968.6 | c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG | p.Pro892fs | frameshift_variant | 26/35 | 5 | NM_000256.3 | ENSP00000442795.1 | ||
MYBPC3 | ENST00000399249.6 | c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG | p.Pro892fs | frameshift_variant | 25/34 | 5 | ENSP00000382193.2 | |||
MYBPC3 | ENST00000544791.1 | n.*153_*178dupACACCACGGTCTCCCTCAAGTGGCGG | non_coding_transcript_exon_variant | 26/27 | 5 | ENSP00000444259.1 | ||||
MYBPC3 | ENST00000544791.1 | n.*153_*178dupACACCACGGTCTCCCTCAAGTGGCGG | 3_prime_UTR_variant | 26/27 | 5 | ENSP00000444259.1 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD3 genomes
Cov.:
30
GnomAD4 exome Cov.: 33
GnomAD4 exome
Cov.:
33
GnomAD4 genome Cov.: 30
GnomAD4 genome
Cov.:
30
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
not provided Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | GeneDx | Nov 01, 2023 | Has not been previously published as pathogenic or benign to our knowledge; Not observed at significant frequency in large population cohorts (gnomAD); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease - |
Hypertrophic cardiomyopathy Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jul 13, 2021 | Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. ClinVar contains an entry for this variant (Variation ID: 454318). This variant has not been reported in the literature in individuals affected with MYBPC3-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Pro892Thrfs*41) in the MYBPC3 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MYBPC3 are known to be pathogenic (PMID: 19574547). For these reasons, this variant has been classified as Pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at