chr11-47349867-AGGCGGCTTCAGGAGGCTGGC-A
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000256.3(MYBPC3):c.541_560delGCCAGCCTCCTGAAGCCGCC(p.Ala181CysfsTer53) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000256.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- hypertrophic cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- hypertrophic cardiomyopathy 4Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
- left ventricular noncompaction 10Inheritance: AR, AD Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
- atrial fibrillationInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- dilated cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000256.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYBPC3 | NM_000256.3 | MANE Select | c.541_560delGCCAGCCTCCTGAAGCCGCC | p.Ala181CysfsTer53 | frameshift | Exon 5 of 35 | NP_000247.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYBPC3 | ENST00000545968.6 | TSL:5 MANE Select | c.541_560delGCCAGCCTCCTGAAGCCGCC | p.Ala181CysfsTer53 | frameshift | Exon 5 of 35 | ENSP00000442795.1 | ||
| MYBPC3 | ENST00000399249.6 | TSL:5 | c.541_560delGCCAGCCTCCTGAAGCCGCC | p.Ala181CysfsTer53 | frameshift | Exon 5 of 34 | ENSP00000382193.2 | ||
| MYBPC3 | ENST00000544791.1 | TSL:5 | n.541_560delGCCAGCCTCCTGAAGCCGCC | non_coding_transcript_exon | Exon 5 of 27 | ENSP00000444259.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hypertrophic cardiomyopathy Pathogenic:1
The Ala181fs has not been reported in the literature. However, this variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 181 and leads to a premature stop codon 53 amino acids downst ream. This alteration is then predicted to lead to a truncated or absent protei n. Loss of function is an established mechanism of disease for the MYBPC3 gene, which makes it highly likely that the Ala181fs variant is pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at