chr12-132675796-CAAACCACCTTTGGATCAGATGAGCCTGAACCCAAGTCACAGCAGTCAGAG-GGTGTAGAAC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP3PP5
The ENST00000537064.5(POLE):n.*68-26_*92delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC variant causes a splice region, non coding transcript exon change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
ENST00000537064.5 splice_region, non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- POLE-related polyposis and colorectal cancer syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- colorectal cancer, susceptibility to, 12Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- facial dysmorphism-immunodeficiency-livedo-short stature syndromeInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
- intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiencyInheritance: AR Classification: STRONG Submitted by: G2P
- IMAGe syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Polymerase proofreading-related adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| POLE | NM_006231.4 | c.1021-26_1045delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC | p.Ala341_Glu349delins??? | splice_acceptor_variant, missense_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | ENST00000320574.10 | NP_006222.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| POLE | ENST00000320574.10 | c.1021-26_1045delCTCTGACTGCTGTGACTTGGGTTCAGGCTCATCTGATCCAAAGGTGGTTTGinsGTTCTACACC | p.Ala341_Glu349delins??? | splice_acceptor_variant, missense_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | 1 | NM_006231.4 | ENSP00000322570.5 |
Frequencies
GnomAD3 genomes
GnomAD4 genome
ClinVar
Submissions by phenotype
not provided Pathogenic:1Uncertain:1
This variant results in the deletion of part of exon 11 (c.1021-26_1045delinsGTTCTACACC) of the POLE gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in POLE are known to be pathogenic (PMID: 23230001, 25948378, 30503519). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 420813). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -
This combined deletion and insertion is denoted POLE c.1021-26_1045del51ins10 and consists of a deletion of 51 nucleotides and the addition of 10 nucleotides at the intron/exon boundary of exon 11. The normal sequence, with the bases that are deleted and duplicated in brackets, is agac[del51][insgttctacacc]AACA where the capital letters are exonic and the lower case are intronic. This variant has not, to our knowledge, been published in the literature. This variant removes the canonical splice acceptor site as well as the first 25 nucleotides of exon 11 and is predicted to cause abnormal gene splicing, leading to either an abnormal message that is subject to nonsense-mediated mRNA decay or to an abnormal protein product. However, while missense variants located within the exonuclease domain of the POLE gene have been recognized as an underlying cause of Polymerase Proofreading-Associated Polyposis (PPAP), an autosomal dominant condition associated with polyposis and an increased risk for colon cancer (Palles 2013, Spier 2015), there are no data to support that loss-of-function variants, such as this one, confer the same cancer risks. Smith et al. (2013) identified a POLE frameshift variant in a 26 year old with a history of colorectal cancer, but no information about family history was provided. Based on current evidence, we consider this variant to be of uncertain significance with respect to cancer. A recessive disease associated with POLE has been reported in the literature. In one large consanguineous family, 14 affected relatives with a syndrome called FILS (facial dysmorphism, immunodeficiency, livedo, and short stature) were all found to be homozygous for POLE c.4444+3A>G, a splice variant which results in a small proportion (~10%) of normal POLE transcript (Pachlopnik Schmid 2012). In addition, an unrelated individual with a suspected chromosome instability syndrome was also found to be homozygous for POLE c.4444+3A>G (Thiffault 2015). We cannot assess whether the variant identified in the current patient would cause the same recessive disease. Individuals and family members of reproductive age may choose to consider assessment of potential reproductive risks. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.1021-26_1045del51insGTTCTACACC variant spans the canonical acceptor site of coding exon 11 in the POLE gene. This variant results from a deletion of 51 nucleotides and insertion of GTTCTACACC nucleotides at positions c.1021-26 to c.1045. This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The canonical acceptor site is highly conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site and may result in the creation or strengthening of a novel splice acceptor site. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. Although biallelic loss of function of POLE has been associated with autosomal recessive POLE deficiency, haploinsufficiency of POLE has not been established as a mechanism of disease for POLE-related polymerase proofreading-associated polyposis (PPAP) and POLE-related CMMRD-like syndrome. Based on the supporting evidence, this variant is expected to be causative of POLE deficiency when present along with a second pathogenic variant on the other allele; however, its clinical significance for PPAP and POLE-related CMMRD-like syndrome is unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at