chr13-20189475-A-AGGATCATAATGCGAAAAATGAAGAGGACGG
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_004004.6(GJB2):c.78_106dupCGTCCTCTTCATTTTTCGCATTATGATCC(p.Leu36ProfsTer9) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. L36L) has been classified as Likely benign. The gene GJB2 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_004004.6 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- Bart-Pumphrey syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- ichthyosis, hystrix-like, with hearing lossInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- keratoderma hereditarium mutilansInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Genomics England PanelApp
- palmoplantar keratoderma-deafness syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, G2P
- syndromic genetic hearing lossInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- autosomal recessive nonsyndromic hearing loss 1AInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- nonsyndromic genetic hearing lossInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- autosomal dominant keratitis-ichthyosis-hearing loss syndromeInheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Genomics England PanelApp
- autosomal dominant nonsyndromic hearing loss 3AInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- autosomal dominant nonsyndromic hearing lossInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- KID syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004004.6. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GJB2 | TSL:1 MANE Select | c.78_106dupCGTCCTCTTCATTTTTCGCATTATGATCC | p.Leu36ProfsTer9 | frameshift stop_gained | Exon 2 of 2 | ENSP00000372299.4 | P29033 | ||
| GJB2 | TSL:6 | c.78_106dupCGTCCTCTTCATTTTTCGCATTATGATCC | p.Leu36ProfsTer9 | frameshift stop_gained | Exon 1 of 1 | ENSP00000372295.1 | P29033 | ||
| GJB2 | c.78_106dupCGTCCTCTTCATTTTTCGCATTATGATCC | p.Leu36ProfsTer9 | frameshift stop_gained | Exon 2 of 2 | ENSP00000576289.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.