chr13-32336751-A-AAGGTAACAATTATGAATCTGATGTTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000059.4(BRCA2):​c.2398_2423dupGGTAACAATTATGAATCTGATGTTGA​(p.Leu809ValfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. E808E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

BRCA2
NM_000059.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:3

Conservation

PhyloP100: 0.457

Publications

1 publications found
Variant links:
Genes affected
BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]
BRCA2 Gene-Disease associations (from GenCC):
  • breast-ovarian cancer, familial, susceptibility to, 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
  • Fanconi anemia complementation group D1
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
  • pancreatic cancer, susceptibility to, 2
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • sarcoma
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary breast ovarian cancer syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Fanconi anemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • medulloblastoma
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 13-32336751-A-AAGGTAACAATTATGAATCTGATGTTG is Pathogenic according to our data. Variant chr13-32336751-A-AAGGTAACAATTATGAATCTGATGTTG is described in ClinVar as [Pathogenic]. Clinvar id is 433767.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA2NM_000059.4 linkc.2398_2423dupGGTAACAATTATGAATCTGATGTTGA p.Leu809ValfsTer10 frameshift_variant Exon 11 of 27 ENST00000380152.8 NP_000050.3 P51587

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA2ENST00000380152.8 linkc.2398_2423dupGGTAACAATTATGAATCTGATGTTGA p.Leu809ValfsTer10 frameshift_variant Exon 11 of 27 5 NM_000059.4 ENSP00000369497.3 P51587
BRCA2ENST00000530893.7 linkc.2029_2054dupGGTAACAATTATGAATCTGATGTTGA p.Leu686ValfsTer10 frameshift_variant Exon 11 of 27 1 ENSP00000499438.2 A0A590UJI7
BRCA2ENST00000614259.2 linkn.2398_2423dupGGTAACAATTATGAATCTGATGTTGA non_coding_transcript_exon_variant Exon 10 of 26 2 ENSP00000506251.1 A0A7P0TAP7

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
33
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:3
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 2 Pathogenic:1
Dec 15, 2017
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)
Significance:Pathogenic
Review Status:reviewed by expert panel
Collection Method:curation

Variant allele predicted to encode a truncated non-functional protein. -

Hereditary cancer-predisposing syndrome Pathogenic:1
Jan 10, 2023
Ambry Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.2398_2423dup26 pathogenic mutation, located in coding exon 10 of the BRCA2 gene, results from a duplication of GGTAACAATTATGAATCTGATGTTGA at nucleotide positions 2398 to 2423, causing a translational frameshift with a predicted alternate stop codon (p.L809Vfs*10). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Hereditary breast ovarian cancer syndrome Pathogenic:1
-
Department of Pathology and Laboratory Medicine, Sinai Health System
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.46
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555282658; hg19: chr13-32910888; API