chr13-32379786-ATTCTCTGTTAACAGAAGGAAAGAGATACAGAATT-A

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_ModeratePM2PP5_Moderate

The NM_001406720.1(BRCA2):​c.8954-13_8974delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT​(p.Glu2985_Tyr2992delinsAsp) variant causes a splice acceptor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

BRCA2
NM_001406720.1 splice_acceptor, disruptive_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 7.22
Variant links:
Genes affected
BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.0110719185 fraction of the gene. Cryptic splice site detected, with MaxEntScore 4.6, offset of -21, new splice context is: tatttggcgtccatcatcAGatt. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 13-32379786-ATTCTCTGTTAACAGAAGGAAAGAGATACAGAATT-A is Pathogenic according to our data. Variant chr13-32379786-ATTCTCTGTTAACAGAAGGAAAGAGATACAGAATT-A is described in ClinVar as [Pathogenic]. Clinvar id is 491367.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA2NM_000059.4 linkc.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT p.Ser2998IlefsTer19 frameshift_variant Exon 23 of 27 ENST00000380152.8 NP_000050.3 P51587

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA2ENST00000380152.8 linkc.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT p.Ser2998IlefsTer19 frameshift_variant Exon 23 of 27 5 NM_000059.4 ENSP00000369497.3 P51587
BRCA2ENST00000530893.7 linkc.8623_8656delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT p.Ser2875IlefsTer19 frameshift_variant Exon 23 of 27 1 ENSP00000499438.2 A0A590UJI7
BRCA2ENST00000614259.2 linkn.*1050_*1083delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT non_coding_transcript_exon_variant Exon 22 of 26 2 ENSP00000506251.1 A0A7P0TAP7
BRCA2ENST00000614259 linkn.*1050_*1083delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT 3_prime_UTR_variant Exon 22 of 25 2 ENSP00000506251.1 A0A7P0TAP7

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1
Feb 10, 2022
Color Diagnostics, LLC DBA Color Health
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant deletes 34 nucleotides in exon 23 of the BRCA2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in individuals affected with early onset and triple-negative breast cancer (PMID: 27616075, Color internal data). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555288450; hg19: chr13-32953923; API