chr13-51937503-GATGGCCACATCCGTGCCGGTGCCA-G
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP3PP5
The NM_000053.4(ATP7B):c.3852_3875delTGGCACCGGCACGGATGTGGCCAT(p.Gly1285_Ile1292del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000547 in 1,461,718 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. I1284I) has been classified as Likely benign.
Frequency
Consequence
NM_000053.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Wilson diseaseInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000053.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATP7B | MANE Select | c.3852_3875delTGGCACCGGCACGGATGTGGCCAT | p.Gly1285_Ile1292del | disruptive_inframe_deletion | Exon 18 of 21 | NP_000044.2 | P35670-1 | ||
| ATP7B | c.3852_3875delTGGCACCGGCACGGATGTGGCCAT | p.Gly1285_Ile1292del | disruptive_inframe_deletion | Exon 19 of 22 | NP_001393440.1 | P35670-1 | |||
| ATP7B | c.3852_3875delTGGCACCGGCACGGATGTGGCCAT | p.Gly1285_Ile1292del | disruptive_inframe_deletion | Exon 19 of 22 | NP_001393441.1 | P35670-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATP7B | TSL:1 MANE Select | c.3852_3875delTGGCACCGGCACGGATGTGGCCAT | p.Gly1285_Ile1292del | disruptive_inframe_deletion | Exon 18 of 21 | ENSP00000242839.5 | P35670-1 | ||
| ATP7B | TSL:1 | c.3708_3731delTGGCACCGGCACGGATGTGGCCAT | p.Gly1237_Ile1244del | disruptive_inframe_deletion | Exon 18 of 21 | ENSP00000489398.1 | B7ZLR4 | ||
| ATP7B | TSL:1 | c.3657_3680delTGGCACCGGCACGGATGTGGCCAT | p.Gly1220_Ile1227del | disruptive_inframe_deletion | Exon 17 of 20 | ENSP00000393343.2 | F5H748 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000547 AC: 8AN: 1461718Hom.: 0 AF XY: 0.00000413 AC XY: 3AN XY: 727146 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at