chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate

The NM_002225.5(IVD):​c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA​(p.Arg410MetfsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

IVD
NM_002225.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 10.0

Publications

0 publications found
Variant links:
Genes affected
IVD (HGNC:6186): (isovaleryl-CoA dehydrogenase) Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]
IVD Gene-Disease associations (from GenCC):
  • isovaleric acidemia
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Myriad Women’s Health, G2P, ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 5 pathogenic variants in the truncated region.
PP5
Variant 15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is Pathogenic according to our data. Variant chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is described in ClinVar as [Pathogenic]. Clinvar id is 551276.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
IVDNM_002225.5 linkc.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA p.Arg410MetfsTer24 frameshift_variant Exon 12 of 12 ENST00000487418.8 NP_002216.3 P26440A0A0A0MT83

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
IVDENST00000487418.8 linkc.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA p.Arg410MetfsTer24 frameshift_variant Exon 12 of 12 1 NM_002225.5 ENSP00000418397.3 A0A0A0MT83

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Isovaleryl-CoA dehydrogenase deficiency Pathogenic:2
Mar 28, 2017
Counsyl
Significance:Likely pathogenic
Review Status:no assertion criteria provided
Collection Method:clinical testing

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Dec 09, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change results in a frameshift in the IVD gene (p.Arg413Metfs*24). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 14 amino acid(s) of the IVD protein and extend the protein by 9 additional amino acid residues. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with IVD-related conditions. ClinVar contains an entry for this variant (Variation ID: 551276). This variant disrupts a region of the IVD protein in which other variant(s) (p.Arg414Trp) have been determined to be pathogenic (PMID: 25220015; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
10

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555405428; hg19: chr15-40710417; API