chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_ModeratePM2PP5_Very_Strong
The NM_002225.5(IVD):c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA(p.Arg410MetfsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_002225.5 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
IVD | NM_002225.5 | c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA | p.Arg410MetfsTer24 | frameshift_variant | Exon 12 of 12 | ENST00000487418.8 | NP_002216.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
IVD | ENST00000487418.8 | c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA | p.Arg410MetfsTer24 | frameshift_variant | Exon 12 of 12 | 1 | NM_002225.5 | ENSP00000418397.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Isovaleryl-CoA dehydrogenase deficiency Pathogenic:2
This sequence change results in a frameshift in the IVD gene (p.Arg413Metfs*24). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 14 amino acid(s) of the IVD protein and extend the protein by 9 additional amino acid residues. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with IVD-related conditions. ClinVar contains an entry for this variant (Variation ID: 551276). This variant disrupts a region of the IVD protein in which other variant(s) (p.Arg414Trp) have been determined to be pathogenic (PMID: 25220015; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at