chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_ModeratePM2PP5_Very_Strong

The NM_002225.5(IVD):​c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA​(p.Arg410fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

IVD
NM_002225.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 10.0
Variant links:
Genes affected
IVD (HGNC:6186): (isovaleryl-CoA dehydrogenase) Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0338 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is Pathogenic according to our data. Variant chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 551276.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
IVDNM_002225.5 linkuse as main transcriptc.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA p.Arg410fs frameshift_variant 12/12 ENST00000487418.8 NP_002216.3 P26440A0A0A0MT83

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
IVDENST00000487418.8 linkuse as main transcriptc.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA p.Arg410fs frameshift_variant 12/121 NM_002225.5 ENSP00000418397.3 A0A0A0MT83

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Isovaleryl-CoA dehydrogenase deficiency Pathogenic:2
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpDec 09, 2023This sequence change results in a frameshift in the IVD gene (p.Arg413Metfs*24). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 14 amino acid(s) of the IVD protein and extend the protein by 9 additional amino acid residues. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with IVD-related conditions. ClinVar contains an entry for this variant (Variation ID: 551276). This variant disrupts a region of the IVD protein in which other variant(s) (p.Arg414Trp) have been determined to be pathogenic (PMID: 25220015; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Likely pathogenic, criteria provided, single submitterclinical testingCounsylMar 28, 2017- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555405428; hg19: chr15-40710417; API