chr15-48489678-GGACCAAACAGTTAAAAACAAAAAGTTCATACTTTTCTAAACAAAGATAATTATATAATTCAGAAAGCAAAAAGTCCATGCTGGGATGATCAAGTAGAGTGCTGAGATCATGAAAATGCATCCTATTTGTCTAAAAAGGGAGGCAATTGGCCATGGAAAACGTAACATTGTACCTTTGAAGAAAGGCTTTCCATT-G
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000138.5(FBN1):c.3061_3082+172del(p.Asn1021fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000138.5 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
FBN1 | NM_000138.5 | c.3061_3082+172del | p.Asn1021fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 25 of 66 | ENST00000316623.10 | NP_000129.3 | |
FBN1 | NM_001406716.1 | c.3061_3082+172del | p.Asn1021fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 24 of 65 | NP_001393645.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Marfan syndrome;C4707243:Familial thoracic aortic aneurysm and aortic dissection Pathogenic:1
This is a large deletion affecting part of exon 25 and extending into intron 25, with one breakpoint at position c.3061 and the other breakpoint at position c.3082+172. This sequence change creates a premature translational stop signal (p.Asn1021Ilefs*7) in the FBN1 gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a FBN1-related disease. Loss-of-function variants in FBN1 are known to be pathogenic (PMID: 17657824, 19293843). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at