chr15-99712504-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001319206.4(MEF2A):c.1259_1285delAGCAGCAGCAGCAGCAGCAGCAGCAGC(p.Gln420_Gln428del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000261 in 1,531,416 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001319206.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001319206.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MEF2A | MANE Select | c.1259_1285delAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln420_Gln428del | disruptive_inframe_deletion | Exon 12 of 12 | NP_001306135.1 | Q02078-2 | ||
| MEF2A | c.1373_1399delAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln458_Gln466del | disruptive_inframe_deletion | Exon 12 of 12 | NP_001386957.1 | ||||
| MEF2A | c.1277_1303delAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln426_Gln434del | disruptive_inframe_deletion | Exon 12 of 12 | NP_001352130.1 | A0A8I5KVQ4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MEF2A | TSL:5 MANE Select | c.1259_1285delAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln420_Gln428del | disruptive_inframe_deletion | Exon 12 of 12 | ENSP00000453095.1 | Q02078-2 | ||
| MEF2A | TSL:1 | c.1241_1267delAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln414_Gln422del | disruptive_inframe_deletion | Exon 11 of 11 | ENSP00000346389.5 | Q02078-5 | ||
| MEF2A | c.1397_1423delAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln466_Gln474del | disruptive_inframe_deletion | Exon 12 of 12 | ENSP00000617065.1 |
Frequencies
GnomAD3 genomes AF: 0.0000133 AC: 2AN: 150286Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.00000145 AC: 2AN: 1381130Hom.: 0 AF XY: 0.00000147 AC XY: 1AN XY: 681108 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000133 AC: 2AN: 150286Hom.: 0 Cov.: 0 AF XY: 0.0000273 AC XY: 2AN XY: 73250 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at