chr16-16203615-TGAGGGGAAGGGAGAGATTAGCTCTGGGTCCCATTTTATACTCTCAGCCGCCAGCGGCAGGGCCAGGCATTAAAGGGTTGTTTTCCCAACAGTGGAGATGGGTGGGTGTGGATCTAGCCTGGCTCCCTCA-T
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001171.6(ABCC6):c.795-131_795-3del variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001171.6 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- arterial calcification, generalized, of infancy, 2Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
- autosomal recessive inherited pseudoxanthoma elasticumInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Labcorp Genetics (formerly Invitae), G2P
- arterial calcification of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ABCC6 | NM_001171.6 | c.795-131_795-3del | splice_region_variant, intron_variant | Intron 7 of 30 | ENST00000205557.12 | NP_001162.5 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Autosomal recessive inherited pseudoxanthoma elasticum Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at