chr16-16203615-TGAGGGGAAGGGAGAGATTAGCTCTGGGTCCCATTTTATACTCTCAGCCGCCAGCGGCAGGGCCAGGCATTAAAGGGTTGTTTTCCCAACAGTGGAGATGGGTGGGTGTGGATCTAGCCTGGCTCCCTCA-T

Variant names:

• chr16-16203615-TGAGGGGAAGGGAGAGATTAGCTCTGGGTCCCATTTTATACTCTCAGCCGCCAGCGGCAGGGCCAGGCATTAAAGGGTTGTTTTCCCAACAGTGGAGATGGGTGGGTGTGGATCTAGCCTGGCTCCCTCA-T
• rs1555518941
• NM_001171.6:c.795-131_795-3del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001171.6(ABCC6):​c.795-131_795-3del variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ABCC6 NM_001171.6 splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.21
• Publications: 0 publications found

Genes affected

ABCC6 (HGNC:57): (ATP binding cassette subfamily C member 6) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]

ABCC6 Gene-Disease associations (from GenCC):

• arterial calcification, generalized, of infancy, 2

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• autosomal recessive inherited pseudoxanthoma elasticum

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Labcorp Genetics (formerly Invitae), G2P
• arterial calcification of infancy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ABCC6	NM_001171.6	c.795-131_795-3del		splice_region_variant, intron_variant	Intron 7 of 30	ENST00000205557.12	NP_001162.5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ABCC6	ENST00000205557.12	c.795-131_795-3del		splice_region_variant, intron_variant	Intron 7 of 30	1	NM_001171.6	ENSP00000205557.7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Autosomal recessive inherited pseudoxanthoma elasticum Uncertain:1

Mar 12, 2021

PXE International

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2
Mutation Taster		=13/87	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555518941; hg19: chr16-16297472;