chr16-2065516-AAGGTGATGGCCCGCTCCCTCTCCCCACCCCCGGAGCTGGAAGAAAGGGATGTGGCCGCATACTCGGCCTCCTTGGAGGATGTGAAGACAGCCGTCCTGGGGCTTCTGGTCATCCTTC-A

Variant names:

• chr16-2065516-AAGGTGATGGCCCGCTCCCTCTCCCCACCCCCGGAGCTGGAAGAAAGGGATGTGGCCGCATACTCGGCCTCCTTGGAGGATGTGAAGACAGCCGTCCTGGGGCTTCTGGTCATCCTTC-A
• rs137854159
• ENST00000219476.9:c.1600_1716del

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP3

The ENST00000219476.9(TSC2):​c.1600_1716del variant causes a exon loss, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TSC2 ENST00000219476.9 exon_loss, splice_region
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 7.97
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
• lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.1603_1716+3del	p.Met535_Gln572del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 16 of 42	ENST00000219476.9	NP_000539.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.1600_1716del		exon_loss_variant, splice_region_variant	Exon 16 of 42	5	NM_000548.5	ENSP00000219476.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs137854159; hg19: chr16-2115517;