chr16-2084361-A-AGCCCCTGAGCAAGTCCAGCTCCTCTCC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_000548.5(TSC2):c.4140_4166dupGCCCCTGAGCAAGTCCAGCTCCTCTCC(p.Pro1389_Glu1390insProLeuSerLysSerSerSerSerPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. P1389P) has been classified as Benign.
Frequency
Consequence
NM_000548.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000137 AC: 2AN: 1460316Hom.: 0 Cov.: 33 AF XY: 0.00000275 AC XY: 2AN XY: 726468
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Tuberous sclerosis 2 Uncertain:1
This variant, c.4140_4166dup, results in the insertion of 9 amino acid(s) of the TSC2 protein (p.Pro1381_Pro1389dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. ClinVar contains an entry for this variant (Variation ID: 535853). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.4140_4166dup27 variant (also known as p.P1381_P1389dup), located in coding exon 33 of the TSC2 gene, results from an in-frame duplication of 27 nucleotides at nucleotide positions 4140 to 4166. This results in the duplication of 9 extra residues (PLSKSSSSP) between codons 1381 and 1389. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at