chr16-2084361-A-AGCCCCTGAGCAAGTCCAGCTCCTCTCC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000548.5(TSC2):c.4140_4166dupGCCCCTGAGCAAGTCCAGCTCCTCTCC(p.Pro1389_Glu1390insProLeuSerLysSerSerSerSerPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. P1389P) has been classified as Likely benign.
Frequency
Consequence
NM_000548.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Ambry Genetics
- lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | NM_000548.5 | MANE Select | c.4140_4166dupGCCCCTGAGCAAGTCCAGCTCCTCTCC | p.Pro1389_Glu1390insProLeuSerLysSerSerSerSerPro | disruptive_inframe_insertion | Exon 34 of 42 | NP_000539.2 | P49815-1 | |
| TSC2 | NM_001406663.1 | c.4137_4163dupGCCCCTGAGCAAGTCCAGCTCCTCTCC | p.Pro1388_Glu1389insProLeuSerLysSerSerSerSerPro | disruptive_inframe_insertion | Exon 34 of 42 | NP_001393592.1 | A0A2R8Y6C9 | ||
| TSC2 | NM_001114382.3 | c.4071_4097dupGCCCCTGAGCAAGTCCAGCTCCTCTCC | p.Pro1366_Glu1367insProLeuSerLysSerSerSerSerPro | disruptive_inframe_insertion | Exon 33 of 41 | NP_001107854.1 | P49815-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | ENST00000219476.9 | TSL:5 MANE Select | c.4140_4166dupGCCCCTGAGCAAGTCCAGCTCCTCTCC | p.Pro1389_Glu1390insProLeuSerLysSerSerSerSerPro | disruptive_inframe_insertion | Exon 34 of 42 | ENSP00000219476.3 | P49815-1 | |
| TSC2 | ENST00000350773.9 | TSL:1 | c.4071_4097dupGCCCCTGAGCAAGTCCAGCTCCTCTCC | p.Pro1366_Glu1367insProLeuSerLysSerSerSerSerPro | disruptive_inframe_insertion | Exon 33 of 41 | ENSP00000344383.4 | P49815-4 | |
| TSC2 | ENST00000401874.7 | TSL:1 | c.3939_3965dupGCCCCTGAGCAAGTCCAGCTCCTCTCC | p.Pro1322_Glu1323insProLeuSerLysSerSerSerSerPro | disruptive_inframe_insertion | Exon 32 of 40 | ENSP00000384468.2 | P49815-5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000137 AC: 2AN: 1460316Hom.: 0 Cov.: 33 AF XY: 0.00000275 AC XY: 2AN XY: 726468 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at