chr16-23629819-AACTGTCGAATTGTTTAGTATCACTGGCAAG-A
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_024675.4(PALB2):c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT(p.Leu769_Ser778del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_024675.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- hereditary breast carcinomaInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics
- Fanconi anemia complementation group NInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- pancreatic cancer, susceptibility to, 3Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- familial ovarian cancerInheritance: AD Classification: MODERATE Submitted by: ClinGen
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary nonpolyposis colon cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_024675.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PALB2 | NM_024675.4 | MANE Select | c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT | p.Leu769_Ser778del | conservative_inframe_deletion | Exon 5 of 13 | NP_078951.2 | ||
| PALB2 | NM_001407296.1 | c.2245_2274delCTTGCCAGTGATACTAAACAATTCGACAGT | p.Leu749_Ser758del | conservative_inframe_deletion | Exon 4 of 12 | NP_001394225.1 | |||
| PALB2 | NM_001407297.1 | c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT | p.Leu769_Ser778del | conservative_inframe_deletion | Exon 5 of 12 | NP_001394226.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PALB2 | ENST00000261584.9 | TSL:1 MANE Select | c.2305_2334delCTTGCCAGTGATACTAAACAATTCGACAGT | p.Leu769_Ser778del | conservative_inframe_deletion | Exon 5 of 13 | ENSP00000261584.4 | ||
| PALB2 | ENST00000568219.5 | TSL:1 | c.1420_1449delCTTGCCAGTGATACTAAACAATTCGACAGT | p.Leu474_Ser483del | conservative_inframe_deletion | Exon 5 of 13 | ENSP00000454703.2 | ||
| PALB2 | ENST00000561514.3 | TSL:5 | c.2311_2340delCTTGCCAGTGATACTAAACAATTCGACAGT | p.Leu771_Ser780del | conservative_inframe_deletion | Exon 5 of 13 | ENSP00000460666.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at