chr16-31489216-T-TCGGCGTGCCCAGCTTTCCTCTG

Variant names:

• chr16-31489216-T-TCGGCGTGCCCAGCTTTCCTCTG
• rs987447860
• NM_003041.4:c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_003041.4(SLC5A2):​c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC​(p.His525ProfsTer49) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000373 in 1,610,198 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000026 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: SLC5A2 NM_003041.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 0.119
• Publications: 0 publications found

Genes affected

SLC5A2 (HGNC:11037): (solute carrier family 5 member 2) This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]

SLC5A2 Gene-Disease associations (from GenCC):

• familial renal glucosuria

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-31489216-T-TCGGCGTGCCCAGCTTTCCTCTG is Pathogenic according to our data. Variant chr16-31489216-T-TCGGCGTGCCCAGCTTTCCTCTG is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 591299.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC5A2	NM_003041.4	c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC	p.His525ProfsTer49	frameshift_variant	Exon 12 of 14	ENST00000330498.4	NP_003032.1
SLC5A2	XM_006721072.5	c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC	p.His525ProfsTer49	frameshift_variant	Exon 12 of 13		XP_006721135.3
SLC5A2	XM_024450402.2	c.1232_1253dupCCAGCTTTCCTCTGCGGCGTGC	p.Leu419GlnfsTer79	frameshift_variant	Exon 10 of 11		XP_024306170.2
SLC5A2	NR_130783.2	n.1246_1267dupCCAGCTTTCCTCTGCGGCGTGC		non_coding_transcript_exon_variant	Exon 10 of 12

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC5A2	ENST00000330498.4	c.1552_1573dupCCAGCTTTCCTCTGCGGCGTGC	p.His525ProfsTer49	frameshift_variant	Exon 12 of 14	1	NM_003041.4	ENSP00000327943.3
SLC5A2	ENST00000419665.6	n.1232_1253dupCCAGCTTTCCTCTGCGGCGTGC		non_coding_transcript_exon_variant	Exon 10 of 12	1		ENSP00000410601.2
SLC5A2	ENST00000568188.1	n.923_944dupCCAGCTTTCCTCTGCGGCGTGC		non_coding_transcript_exon_variant	Exon 3 of 3	2
SLC5A2	ENST00000568891.1	n.384_405dupCCAGCTTTCCTCTGCGGCGTGC		non_coding_transcript_exon_variant	Exon 2 of 4	5

Frequencies

GnomAD3 genomes AF: 0.0000263 AC: 4 AN: 152208 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000965

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1457990 Hom.: 0 Cov.: 33 AF XY: 0.00000276 AC XY: 2 AN XY: 725530

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.0000224 AC: 1 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111976

Other (OTH) AF: 0.0000166 AC: 1 AN: 60360

GnomAD4 genome AF: 0.0000263 AC: 4 AN: 152208 Hom.: 0 Cov.: 33 AF XY: 0.0000403 AC XY: 3 AN XY: 74362

African (AFR) AF: 0.0000965 AC: 4 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15288

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5184

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68040

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial renal glucosuria Pathogenic:1

Apr 13, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Uncertain:1

Sep 16, 2018

Gharavi Laboratory, Columbia University

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.12
Mutation Taster		=27/173	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs987447860; hg19: chr16-31500537;