chr17-3658081-TCGTGGCTGCAGTGGGAGTGACCA-T
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_004937.3(CTNS):c.771_793delGGGAGTGACCACGTGGCTGCAGT(p.Gly258SerfsTer30) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000093 in 1,612,260 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_004937.3 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CTNS | NM_004937.3 | c.771_793delGGGAGTGACCACGTGGCTGCAGT | p.Gly258SerfsTer30 | frameshift_variant | Exon 10 of 12 | ENST00000046640.9 | NP_004928.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000132 AC: 2AN: 152072Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.0000279 AC: 7AN: 251296Hom.: 0 AF XY: 0.0000294 AC XY: 4AN XY: 135878
GnomAD4 exome AF: 0.00000890 AC: 13AN: 1460070Hom.: 0 AF XY: 0.0000110 AC XY: 8AN XY: 726384
GnomAD4 genome AF: 0.0000131 AC: 2AN: 152190Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1AN XY: 74420
ClinVar
Submissions by phenotype
Nephropathic cystinosis Pathogenic:5
- -
This 23 bp deletion in CTNS has been previously reported in individuals with nephropathic cystinosis. This CTNS variant (rs759623796) is rare (<0.1%) in a large population dataset (gnomAD: 7/251296 total alleles; 0.003%; no homozygotes) and there is an entry in ClinVar. This frameshift variant results in a premature stop codon in exon 11 likely leading to nonsense-mediated decay and lack of protein production. We consider this variant to be pathogenic. -
- -
- -
The observed frameshift c.771_793del (p.Gly258SerfsTer30) variant in CTNS gene has been reported in homozygous state in individual(s) affected with cystinosis (Chkioua L et al., 2015; Ghazi F, et. al., 2017). The p.Gly258SerfsTer30 variant is present with allele frequency 0.003% in gnomAD Exomes database. This variant has been submitted to the ClinVar database as Likely Pathogenic / Pathogenic (multiple submitters). This variant causes a frameshift starting with codon Glycine 258, changes this amino acid to Serine residue, and creates a premature Stop codon at position 30 of the new reading frame, denoted p.Gly258SerfsTer30. This variant is predicted to cause loss of normal protein function through protein truncation. Loss-of-function variants in CTNS are known to be pathogenic (Elmonem MA, et. al., 2016). For these reasons, this variant has been classified as Pathogenic. -
Cystinosis Pathogenic:3
- -
Variant summary: The variant results in the deletion of a 23 nucleotides leading to a termination codon at position 288 of CTNS. The variant was present at a low frequency in the large and broad cohorts of the ExAC project (3/121,076 chromosomes) while it was observed in multiple CTNS patients in the literature. Considering all evidence, the variant was classified as pathogenic. -
- -
Juvenile nephropathic cystinosis;C2931013:Ocular cystinosis;C2931187:Nephropathic cystinosis Pathogenic:1
- -
not provided Pathogenic:1
- -
Juvenile nephropathic cystinosis;C0950123:Inborn genetic diseases;C2931013:Ocular cystinosis Pathogenic:1
This sequence change creates a premature translational stop signal (p.Gly258Serfs*30) in the CTNS gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CTNS are known to be pathogenic (PMID: 9537412, 27102039). This variant is present in population databases (rs759623796, gnomAD 0.02%). This premature translational stop signal has been observed in individuals with cystinosis (PMID: 10556299, 26266097). This variant is also known as c.1109_1131del23. ClinVar contains an entry for this variant (Variation ID: 496276). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at