chr17-43115725-CTTGCAAAATATGTGGTCACACTTTGTGGAGACAGGTTCCTTGATCAACTCCAGA-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PM2PP5_Very_Strong

The NM_007294.4(BRCA1):​c.81_134delTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA variant causes a exon loss, splice region change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★).

Frequency

Genomes: not found (cov: 32)

Consequence

BRCA1
NM_007294.4 exon_loss, splice_region

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:2

Conservation

PhyloP100: 4.40
Variant links:
Genes affected
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-43115725-CTTGCAAAATATGTGGTCACACTTTGTGGAGACAGGTTCCTTGATCAACTCCAGA-C is Pathogenic according to our data. Variant chr17-43115725-CTTGCAAAATATGTGGTCACACTTTGTGGAGACAGGTTCCTTGATCAACTCCAGA-C is described in ClinVar as [Pathogenic]. Clinvar id is 224416.Status of the report is reviewed_by_expert_panel, 3 stars. Variant chr17-43115725-CTTGCAAAATATGTGGTCACACTTTGTGGAGACAGGTTCCTTGATCAACTCCAGA-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
BRCA1NM_007294.4 linkuse as main transcriptc.81_134delTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA exon_loss_variant, splice_region_variant 3/23 ENST00000357654.9 NP_009225.1 P38398-1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
BRCA1ENST00000357654.9 linkuse as main transcriptc.81_134delTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA exon_loss_variant, splice_region_variant 3/231 NM_007294.4 ENSP00000350283.3 P38398-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 1 Pathogenic:1
Pathogenic, reviewed by expert panelcurationEvidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)Dec 15, 2017Variant allele predicted to encode a truncated non-functional protein. -
Breast neoplasm Pathogenic:1
Pathogenic, criteria provided, single submitterresearchLaboratory of Molecular Diagnosis of Cancer, West China Hospital, Sichuan UniversityNov 01, 2015- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555599208; hg19: chr17-41267742; API