chr17-58216279-CATTATAATACATCAAACTTTTGCTTCTGTAACTGTTTAATCAAATCAGTTCTACAGAACTGATGCTATCTGACATGTTTTCATAACCAACACTAAACTAATGAATGGCAGGGGAACCAAGAACATTAGAGCTAAAAGGAACCA-C
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate
The NM_017777.4(MKS1):c.262-179_262-37del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). There are indicators that this mutation may affect the branch point..
Frequency
Consequence
NM_017777.4 intron
Scores
Clinical Significance
Conservation
Publications
- Bardet-Biedl syndrome 13Inheritance: AR, Unknown Classification: DEFINITIVE, STRONG, LIMITED Submitted by: G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- ciliopathyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- Meckel syndrome, type 1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Myriad Women’s Health
- Joubert syndrome 28Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Bardet-Biedl syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Joubert syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Joubert syndrome with ocular defectInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Meckel syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_017777.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MKS1 | NM_017777.4 | MANE Select | c.262-179_262-37del | intron | N/A | NP_060247.2 | Q9NXB0-1 | ||
| MKS1 | NM_001321269.2 | c.262-179_262-37del | intron | N/A | NP_001308198.1 | A0A7I2V2M0 | |||
| MKS1 | NM_001330397.2 | c.262-179_262-37del | intron | N/A | NP_001317326.1 | H0Y2S2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MKS1 | ENST00000393119.7 | TSL:1 MANE Select | c.262-179_262-37del | intron | N/A | ENSP00000376827.2 | Q9NXB0-1 | ||
| MKS1 | ENST00000537529.7 | TSL:1 | c.-168-179_-168-37del | intron | N/A | ENSP00000442096.3 | A0A0S2Z5Z2 | ||
| MKS1 | ENST00000966002.1 | c.262-179_262-37del | intron | N/A | ENSP00000636061.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at