chr17-58703294-T-TATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTATGAGTCAGACTACTGAAATGTAACTAACCAAGTATTTTTTGAGGTGTTTGATAAGCATGAA
Variant summary
Our verdict is Uncertain significance. Variant got 0 ACMG points: 1P and 1B. PP3BP6
The NM_058216.3(RAD51C):c.672_705+65dupTCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTATGAGTCAGACTACTGAAATGTAACTAACCAAGTATTTTTTGAGGTGTTTGATAAGCATGAAA variant causes a intron change involving the alteration of a conserved nucleotide. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_058216.3 intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 0 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 152218Hom.: 0 Cov.: 31 FAILED QC
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000480 AC: 7AN: 1459194Hom.: 0 Cov.: 31 AF XY: 0.00000275 AC XY: 2AN XY: 726070
GnomAD4 genome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0AN: 152218Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 74374
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Uncertain:1Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
This variant causes a duplication of the 3' end of exon 4 and the 5' end of intron 4 of the RAD51C gene. This variant creates a duplicate copy of the intron 4 splice donor site, however, the splicing impact if any has not been functionally tested. To our knowledge, functional studies have not been performed for this variant. This variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Fanconi anemia complementation group O Benign:1
- -
Fanconi anemia complementation group O;C3150659:Breast-ovarian cancer, familial, susceptibility to, 3 Other:1
Variant interpreted as Uncertain significance and reported on 06-12-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at