chr17-65558612-GCTACTCATGGTGAGGGAGCT-G
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 8P and 4B. PVS1BS2
The NM_004655.4(AXIN2):c.-12_8delAGCTCCCTCACCATGAGTAG(p.Met1fs) variant causes a frameshift, start lost change. The variant allele was found at a frequency of 0.0000124 in 1,606,462 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_004655.4 frameshift, start_lost
Scores
Clinical Significance
Conservation
Publications
- oligodontia-cancer predisposition syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)
- tooth agenesisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- craniosynostosisInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt | 
|---|---|---|---|---|---|---|---|---|
| AXIN2 | NM_004655.4 | c.-12_8delAGCTCCCTCACCATGAGTAG | p.Met1fs | frameshift_variant, start_lost | Exon 2 of 11 | ENST00000307078.10 | NP_004646.3 | |
| AXIN2 | NM_004655.4 | c.-12_8delAGCTCCCTCACCATGAGTAG | 5_prime_UTR_variant | Exon 2 of 11 | ENST00000307078.10 | NP_004646.3 | 
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt | 
|---|---|---|---|---|---|---|---|---|---|---|
| AXIN2 | ENST00000307078.10 | c.-12_8delAGCTCCCTCACCATGAGTAG | p.Met1fs | frameshift_variant, start_lost | Exon 2 of 11 | 1 | NM_004655.4 | ENSP00000302625.5 | ||
| ENSG00000266076 | ENST00000577662.1 | n.*165_*184delAGCTCCCTCACCATGAGTAG | non_coding_transcript_exon_variant | Exon 4 of 7 | 2 | ENSP00000462418.1 | ||||
| AXIN2 | ENST00000307078.10 | c.-12_8delAGCTCCCTCACCATGAGTAG | 5_prime_UTR_variant | Exon 2 of 11 | 1 | NM_004655.4 | ENSP00000302625.5 | |||
| ENSG00000266076 | ENST00000577662.1 | n.*165_*184delAGCTCCCTCACCATGAGTAG | 3_prime_UTR_variant | Exon 4 of 7 | 2 | ENSP00000462418.1 | 
Frequencies
GnomAD3 genomes  0.0000131  AC: 2AN: 152140Hom.:  0  Cov.: 32 show subpopulations 
GnomAD2 exomes  AF:  0.00000828  AC: 2AN: 241688 AF XY:  0.00000757   show subpopulations 
GnomAD4 exome  AF:  0.0000124  AC: 18AN: 1454322Hom.:  0   AF XY:  0.0000111  AC XY: 8AN XY: 723876 show subpopulations 
Age Distribution
GnomAD4 genome  0.0000131  AC: 2AN: 152140Hom.:  0  Cov.: 32 AF XY:  0.0000135  AC XY: 1AN XY: 74312 show subpopulations 
ClinVar
Submissions by phenotype
not provided    Uncertain:4 
- -
Deletion involving the initiation codon in a gene for which a downstream in-frame ATG could serve as an alternate initiator codon; Observed in an individual with breast cancer (PMID: 26681312); Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 15611123, 26681312, 36502525) -
The AXIN2 c.-12_8del; p.Met1? variant (rs768265778) is reported in the literature in at least one individual affected with breast cancer (Susswein 2016). This variant is also reported in ClinVar (Variation ID: 239971), and is only observed on two alleles in the Genome Aggregation Database, indicating it is not a common polymorphism. This variant causes loss of the canonical initiator methionine codon by deleting 12 nucleotides upstream of the ATG start site and 8 nucleotides of the coding region. While this variant is predicted to disrupt protein translation from the normal start site, there is an alternate in-frame methionine located just downstream. However, without functional studies, the effect of this variant on translation is unknown. Due to limited information, the clinical significance of the c.-12_8del; p.Met1? variant is uncertain at this time. References: Susswein LR et al. Pathogenic and likely pathogenic variant prevalence among the first 10,000 patients referred for next-generation cancer panel testing. Genet Med. 2016 Aug;18(8):823-32. -
The AXIN2 c.-12_8del variant disrupts the translation initiation codon of the AXIN2 mRNA and is predicted to interfere with AXIN2 protein synthesis, however there is alternate in-frame methionine located downstream at the 5th codon that results in a biologically relevant transcript. In the published literature, this variant has been reported in individuals with colorectal polyps and intestinal cancer (PMID: 36502525 (2022)) and breast cancer (PMID: 26681312 (2015)). The frequency of this variant in the general population, 0.0000083 (2/241688 chromosomes (Genome Aggregation Database, http://gnomad.broadinstitute.org)), is uninformative in the assessment of its pathogenicity. Based on the available information, we are unable to determine the clinical significance of this variant. -
Oligodontia-cancer predisposition syndrome;C5680012:AXIN2-related attenuated familial adenomatous polyposis    Pathogenic:1 
- -
Oligodontia-cancer predisposition syndrome    Uncertain:1 
This sequence change affects the initiator methionine of the AXIN2 mRNA. The next in-frame methionine is located at codon 5. This variant is present in population databases (rs768265778, gnomAD 0.007%). Disruption of the initiator codon has been observed in individual(s) with clinical features of AXIN2-related conditions (PMID: 26681312, 36502525). ClinVar contains an entry for this variant (Variation ID: 239971). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Colorectal cancer    Uncertain:1 
- -
Hereditary cancer-predisposing syndrome    Uncertain:1 
The c.-12_8del20 variant (also known as p.M1?) is located in coding exon 1 of the AXIN2 gene and results from a deletion of 20 nucleotides at positions c.-12 to c.8. This removes the methionine residue at the initiation codon. This alteration was identified in 1/10030 consecutive patients referred for evaluation by an NGS hereditary cancer panel (Susswein LR et al. Genet. Med., 2016 08;18:823-32). This variant has been reported in a French family with oligodontia (Leclerc J et al. Genes Chromosomes Cancer. 2023 Apr;62(4):210-222). This alteration has been observed in at least one individual with a personal and/or family history that is consistent with AXIN2-related disease but also in unaffected individuals (Ambry internal data). Variations that modify the initiation codon (ATG) are expected to result in either loss of translation initiation, N-terminal truncation, or cause a shift in the mRNA reading frame; however, there is an alternate in-frame methionine 4 amino acids from the initiation site, which may result in N-terminal truncation of unknown significance. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
Computational scores
Source: 
Splicing
 Find out detailed SpliceAI scores and Pangolin per-transcript scores at