chr17-7675047-GCTCACCATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGC-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000546.6(TP53):​c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG​(p.Arg175fs) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

TP53
NM_000546.6 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 6.01
Variant links:
Genes affected
TP53 (HGNC:11998): (tumor protein p53) This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-7675047-GCTCACCATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGC-G is Pathogenic according to our data. Variant chr17-7675047-GCTCACCATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGC-G is described in ClinVar as [Pathogenic]. Clinvar id is 528272.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TP53NM_000546.6 linkc.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG p.Arg175fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 5 of 11 ENST00000269305.9 NP_000537.3 P04637-1K7PPA8Q53GA5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TP53ENST00000269305.9 linkc.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG p.Arg175fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 5 of 11 1 NM_000546.6 ENSP00000269305.4 P04637-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Li-Fraumeni syndrome Pathogenic:1
Sep 01, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 528272). This variant has not been reported in the literature in individuals affected with TP53-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 5 (c.522_559+5del43) of the TP53 gene. This deletion is out-of-frame, and is expected to create a premature termination codon and result in an absent or disrupted protein product. Loss-of-function variants in TP53 are known to be pathogenic (PMID: 20522432). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555525957; hg19: chr17-7578365; API