chr18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGC-G
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1
The NM_001083962.2(TCF4):c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0145 in 571,664 control chromosomes in the GnomAD database, including 718 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene TCF4 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_001083962.2 intron
Scores
Clinical Significance
Conservation
Publications
- Pitt-Hopkins syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, G2P, ClinGen, PanelApp Australia, Labcorp Genetics (formerly Invitae)
- corneal dystrophy, Fuchs endothelial, 3Inheritance: AD Classification: STRONG Submitted by: G2P
- autosomal dominant non-syndromic intellectual disabilityInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fuchs' endothelial dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autism spectrum disorderInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- intellectual disabilityInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001083962.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TCF4 | MANE Select | c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | NP_001077431.1 | P15884-3 | |||
| TCF4 | c.379-825_379-802delGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | NP_001230155.2 | E9PH57 | ||||
| TCF4 | c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | NP_001230157.1 | H3BTP3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TCF4 | TSL:5 MANE Select | c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | ENSP00000346440.3 | P15884-3 | |||
| TCF4 | TSL:1 | c.379-825_379-802delGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | ENSP00000381382.1 | E9PH57 | |||
| TCF4 | TSL:1 | c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT | intron | N/A | ENSP00000348374.4 | P15884-1 |
Frequencies
GnomAD3 genomes AF: 0.0366 AC: 4961AN: 135388Hom.: 166 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0145 AC: 8268AN: 571664Hom.: 718 AF XY: 0.0140 AC XY: 4194AN XY: 298682 show subpopulations
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0366 AC: 4962AN: 135480Hom.: 166 Cov.: 0 AF XY: 0.0356 AC XY: 2331AN XY: 65532 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.