chr19-11061814-T-TGAGCCCCGACATTCCAGTCTCGACCCC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_003072.5(SMARCA4):c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_003072.5 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- Coffin-Siris syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen, Illumina
- intellectual disability, autosomal dominant 16Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- rhabdoid tumor predisposition syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae)
- otosclerosisInheritance: AD Classification: STRONG Submitted by: PanelApp Australia
- uterine corpus sarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- familial rhabdoid tumorInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary nonpolyposis colon cancerInheritance: Unknown Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003072.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMARCA4 | MANE Plus Clinical | c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC | 3_prime_UTR | Exon 36 of 36 | NP_001374212.1 | Q9HBD4 | |||
| SMARCA4 | MANE Select | c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC | 3_prime_UTR | Exon 35 of 35 | NP_003063.2 | ||||
| SMARCA4 | c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC | 3_prime_UTR | Exon 36 of 36 | NP_001122321.1 | Q9HBD4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMARCA4 | MANE Plus Clinical | c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC | 3_prime_UTR | Exon 36 of 36 | ENSP00000495368.1 | Q9HBD4 | |||
| SMARCA4 | TSL:1 MANE Select | c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC | 3_prime_UTR | Exon 35 of 35 | ENSP00000343896.4 | P51532-1 | |||
| SMARCA4 | c.*6_*32dupGACATTCCAGTCTCGACCCCGAGCCCC | 3_prime_UTR | Exon 35 of 35 | ENSP00000493975.1 | A0A2R8Y4P4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at