chr19-11105250-GCTGCCACGATGGGAAGTGCAT-G

Variant names:

• chr19-11105250-GCTGCCACGATGGGAAGTGCAT-G
• rs879254484
• NM_000527.5:c.347_367delGCCACGATGGGAAGTGCATCT

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1 PM4 PP3 PP5_Very_Strong

The NM_000527.5(LDLR):​c.347_367delGCCACGATGGGAAGTGCATCT​(p.Cys116_Ile122del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. C116C) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: LDLR NM_000527.5 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 9.82
• Publications: 0 publications found

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR Gene-Disease associations (from GenCC):

• hypercholesterolemia, familial, 1

  Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
• homozygous familial hypercholesterolemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PM1: In a hotspot region, there are 21 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 3 benign, 11 uncertain in NM_000527.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000527.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 19-11105250-GCTGCCACGATGGGAAGTGCAT-G is Pathogenic according to our data. Variant chr19-11105250-GCTGCCACGATGGGAAGTGCAT-G is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 251165.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000527.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	NM_000527.5	MANE Select	c.347_367delGCCACGATGGGAAGTGCATCT	p.Cys116_Ile122del	disruptive_inframe_deletion	Exon 4 of 18	NP_000518.1
	LDLR	NM_001195798.2		c.347_367delGCCACGATGGGAAGTGCATCT	p.Cys116_Ile122del	disruptive_inframe_deletion	Exon 4 of 18	NP_001182727.1
	LDLR	NM_001195799.2		c.224_244delGCCACGATGGGAAGTGCATCT	p.Cys75_Ile81del	disruptive_inframe_deletion	Exon 3 of 17	NP_001182728.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	ENST00000558518.6	TSL:1 MANE Select	c.347_367delGCCACGATGGGAAGTGCATCT	p.Cys116_Ile122del	disruptive_inframe_deletion	Exon 4 of 18	ENSP00000454071.1
	LDLR	ENST00000252444.10	TSL:1	c.605_625delGCCACGATGGGAAGTGCATCT	p.Cys202_Ile208del	disruptive_inframe_deletion	Exon 4 of 18	ENSP00000252444.6
	LDLR	ENST00000558013.5	TSL:1	c.347_367delGCCACGATGGGAAGTGCATCT	p.Cys116_Ile122del	disruptive_inframe_deletion	Exon 4 of 18	ENSP00000453346.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:2

Nov 05, 2016

Molecular Genetics Laboratory, Centre for Cardiovascular Surgery and Transplantation

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Disrupt disulfide bridge between Cys109 and Cys121.

Mar 25, 2016

LDLR-LOVD, British Heart Foundation

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: literature only

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs879254484; hg19: chr19-11215926;