chr19-11105555-GATGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGA-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000527.5(LDLR):c.651_687delTGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGAA(p.Asp217GlufsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. D217D) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000527.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- hypercholesterolemia, familial, 1Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
- homozygous familial hypercholesterolemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
LDLR | NM_000527.5 | c.651_687delTGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGAA | p.Asp217GlufsTer36 | frameshift_variant | Exon 4 of 18 | ENST00000558518.6 | NP_000518.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Hypercholesterolemia, familial, 1 Pathogenic:1
- -
Familial hypercholesterolemia Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 251351). This variant is also known as del 37 in codon 196-208. This premature translational stop signal has been observed in individual(s) with familial hypercholesterolemia (PMID: 7649546). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Asp217Glufs*36) in the LDLR gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in LDLR are known to be pathogenic (PMID: 20809525, 28645073). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at