chr19-11113555-ACGGCGTCTCTTCCTATGACACCG-CAGCTTGACCCGC
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000527.5(LDLR):c.1379_1402delACGGCGTCTCTTCCTATGACACCGinsCAGCTTGACCCGC(p.His460fs) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 31)
Consequence
LDLR
NM_000527.5 frameshift, stop_gained
NM_000527.5 frameshift, stop_gained
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 4.79
Genes affected
LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]
MIR6886 (HGNC:50121): (microRNA 6886) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 19-11113555-ACGGCGTCTCTTCCTATGACACCG-CAGCTTGACCCGC is Pathogenic according to our data. Variant chr19-11113555-ACGGCGTCTCTTCCTATGACACCG-CAGCTTGACCCGC is described in ClinVar as [Pathogenic]. Clinvar id is 251822.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
LDLR | NM_000527.5 | c.1379_1402delACGGCGTCTCTTCCTATGACACCGinsCAGCTTGACCCGC | p.His460fs | frameshift_variant, stop_gained | 10/18 | ENST00000558518.6 | NP_000518.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 31
GnomAD4 genome
Cov.:
31
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Hypercholesterolemia, familial, 1 Pathogenic:1
Pathogenic, criteria provided, single submitter | literature only | LDLR-LOVD, British Heart Foundation | Mar 25, 2016 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at