Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000527.5(LDLR):c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC(p.Val506HisfsTer14) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V506V) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]
MIR6886 (HGNC:50121): (microRNA 6886) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Our verdict: Pathogenic. The variant received 10 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is Pathogenic according to our data. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A is described in CliVar as Pathogenic. Clinvar id is 251880.Status of the report is criteria_provided_single_submitter, 1 stars.