chr19-13207858-CCTGCTGCTGCTGCTGCTGCTG-C
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1BS2
The NM_001127222.2(CACNA1A):c.6955_6975delCAGCAGCAGCAGCAGCAGCAG(p.Gln2319_Gln2325del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000175 in 1,430,526 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001127222.2 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- episodic ataxia type 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- undetermined early-onset epileptic encephalopathyInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina
- developmental and epileptic encephalopathy, 42Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- migraine, familial hemiplegic, 1Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- spinocerebellar ataxia type 6Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
- benign paroxysmal torticollis of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial or sporadic hemiplegic migraineInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Lennox-Gastaut syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CACNA1A | ENST00000360228.11 | c.6955_6975delCAGCAGCAGCAGCAGCAGCAG | p.Gln2319_Gln2325del | conservative_inframe_deletion | Exon 47 of 47 | 1 | NM_001127222.2 | ENSP00000353362.5 | ||
CACNA1A | ENST00000638029.1 | c.6973_6993delCAGCAGCAGCAGCAGCAGCAG | p.Gln2325_Gln2331del | conservative_inframe_deletion | Exon 48 of 48 | 5 | ENSP00000489829.1 | |||
CACNA1A | ENST00000573710.7 | c.6961_6981delCAGCAGCAGCAGCAGCAGCAG | p.Gln2321_Gln2327del | conservative_inframe_deletion | Exon 47 of 47 | 5 | ENSP00000460092.3 | |||
CACNA1A | ENST00000635727.1 | c.6958_6978delCAGCAGCAGCAGCAGCAGCAG | p.Gln2320_Gln2326del | conservative_inframe_deletion | Exon 47 of 47 | 5 | ENSP00000490001.1 | |||
CACNA1A | ENST00000637769.1 | c.6958_6978delCAGCAGCAGCAGCAGCAGCAG | p.Gln2320_Gln2326del | conservative_inframe_deletion | Exon 47 of 47 | 1 | ENSP00000489778.1 | |||
CACNA1A | ENST00000636012.1 | c.6922_6942delCAGCAGCAGCAGCAGCAGCAG | p.Gln2308_Gln2314del | conservative_inframe_deletion | Exon 46 of 46 | 5 | ENSP00000490223.1 | |||
CACNA1A | ENST00000637736.1 | c.6817_6837delCAGCAGCAGCAGCAGCAGCAG | p.Gln2273_Gln2279del | conservative_inframe_deletion | Exon 46 of 46 | 5 | ENSP00000489861.1 | |||
CACNA1A | ENST00000636768.2 | n.*1216_*1236delCAGCAGCAGCAGCAGCAGCAG | non_coding_transcript_exon_variant | Exon 45 of 45 | 5 | ENSP00000490190.2 | ||||
CACNA1A | ENST00000713789.1 | n.*2134_*2154delCAGCAGCAGCAGCAGCAGCAG | non_coding_transcript_exon_variant | Exon 47 of 47 | ENSP00000519091.1 | |||||
CACNA1A | ENST00000636389.1 | c.*41_*61delCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 47 of 47 | 5 | ENSP00000489992.1 | ||||
CACNA1A | ENST00000637432.1 | c.*167_*187delCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 48 of 48 | 5 | ENSP00000490617.1 | ||||
CACNA1A | ENST00000635895.1 | c.*167_*187delCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 47 of 47 | 5 | ENSP00000490323.1 | ||||
CACNA1A | ENST00000638009.2 | c.*167_*187delCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 47 of 47 | 1 | ENSP00000489913.1 | ||||
CACNA1A | ENST00000637276.1 | c.*167_*187delCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 46 of 46 | 5 | ENSP00000489777.1 | ||||
CACNA1A | ENST00000636768.2 | n.*1216_*1236delCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 45 of 45 | 5 | ENSP00000490190.2 | ||||
CACNA1A | ENST00000713789.1 | n.*2134_*2154delCAGCAGCAGCAGCAGCAGCAG | 3_prime_UTR_variant | Exon 47 of 47 | ENSP00000519091.1 | |||||
CACNA1A | ENST00000636549.1 | c.*167_*187delCAGCAGCAGCAGCAGCAGCAG | downstream_gene_variant | 5 | ENSP00000490578.1 | |||||
CACNA1A | ENST00000637927.1 | c.*167_*187delCAGCAGCAGCAGCAGCAGCAG | downstream_gene_variant | 5 | ENSP00000489715.1 |
Frequencies
GnomAD3 genomes AF: 0.000352 AC: 52AN: 147802Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.000156 AC: 200AN: 1282622Hom.: 0 AF XY: 0.000184 AC XY: 116AN XY: 631208 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000345 AC: 51AN: 147904Hom.: 0 Cov.: 0 AF XY: 0.000361 AC XY: 26AN XY: 72002 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at