chr19-13317145-AGTGAACAATAGCAACACACAGC-A

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_001127222.2(CACNA1A):​c.1500_1521delGCTGTGTGTTGCTATTGTTCAC​(p.Leu501ThrfsTer19) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

CACNA1A
NM_001127222.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3

Conservation

PhyloP100: 9.93
Variant links:
Genes affected
CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 19-13317145-AGTGAACAATAGCAACACACAGC-A is Pathogenic according to our data. Variant chr19-13317145-AGTGAACAATAGCAACACACAGC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 446903.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CACNA1ANM_001127222.2 linkc.1500_1521delGCTGTGTGTTGCTATTGTTCAC p.Leu501ThrfsTer19 frameshift_variant Exon 11 of 47 ENST00000360228.11 NP_001120694.1 O00555-8

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CACNA1AENST00000360228.11 linkc.1500_1521delGCTGTGTGTTGCTATTGTTCAC p.Leu501ThrfsTer19 frameshift_variant Exon 11 of 47 1 NM_001127222.2 ENSP00000353362.5 O00555-8
CACNA1AENST00000638029.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 48 5 ENSP00000489829.1 A0A087WW63
CACNA1AENST00000573710.7 linkc.1506_1527delGCTGTGTGTTGCTATTGTTCAC p.Leu503ThrfsTer19 frameshift_variant Exon 11 of 47 5 ENSP00000460092.3 A0A1C7CYY9
CACNA1AENST00000635727.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 47 5 ENSP00000490001.1 A0A1B0GU81
CACNA1AENST00000637769.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 47 1 ENSP00000489778.1 A0A1B0GTN7
CACNA1AENST00000636012.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 46 5 ENSP00000490223.1 A0A1B0GUS3
CACNA1AENST00000637736.1 linkc.1362_1383delGCTGTGTGTTGCTATTGTTCAC p.Leu455ThrfsTer19 frameshift_variant Exon 10 of 46 5 ENSP00000489861.1 A0A1B0GTW2
CACNA1AENST00000636389.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 47 5 ENSP00000489992.1 A0A1B0GU74
CACNA1AENST00000637432.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 48 5 ENSP00000490617.1 O00555-2
CACNA1AENST00000636549.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 48 5 ENSP00000490578.1 B5TYJ1
CACNA1AENST00000637927.1 linkc.1506_1527delGCTGTGTGTTGCTATTGTTCAC p.Leu503ThrfsTer19 frameshift_variant Exon 11 of 47 5 ENSP00000489715.1 A0A1B0GTI4
CACNA1AENST00000635895.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 47 5 ENSP00000490323.1 A0A384DVW2
CACNA1AENST00000638009.2 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 47 1 ENSP00000489913.1 O00555-3
CACNA1AENST00000637276.1 linkc.1503_1524delGCTGTGTGTTGCTATTGTTCAC p.Leu502ThrfsTer19 frameshift_variant Exon 11 of 46 5 ENSP00000489777.1 O00555-5

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

not provided Pathogenic:2
Jan 31, 2017
Athena Diagnostics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Oct 29, 2018
GeneDx
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.1503_1524del22 variant in the CACNA1A gene has not been reported previously as a pathogenic variant, nor as a benign variant, to our knowledge. The c.1503_1524del22 variant causes a frameshift starting with codon Leucine 502, changes this amino acid to a Threonine residue, and creates a premature Stop codon at position 19 of the new reading frame, denoted p.Leu502ThrfsX19. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. The c.1503_1524del22 variant is not observed in large population cohorts (Lek et al., 2016). We interpret c.1503_1524del22 as a likely pathogenic variant. -

Episodic ataxia type 2;C4310716:Developmental and epileptic encephalopathy, 42 Pathogenic:1
May 08, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss-of-function variants in CACNA1A are known to be pathogenic (PMID: 14718690, 10371528). This sequence change deletes 22 nucleotides from exon 11 of the CACNA1A mRNA (c.1503_1524del), causing a frameshift at codon 502. This creates a premature translational stop signal (p.Leu502Thrfs*19) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555762855; hg19: chr19-13427959; API