chr19-38494362-G-GGAGCTGGTGTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCC
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1PM4
The NM_000540.3(RYR1):c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG(p.Ser2099_Val2117dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000274 in 1,459,160 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000540.3 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- malignant hyperthermia, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
- congenital multicore myopathy with external ophthalmoplegiaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- RYR1-related myopathyInheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
- central core myopathyInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
- King-Denborough syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant hyperthermia of anesthesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive centronuclear myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- benign Samaritan congenital myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- congenital myopathy with myasthenic-like onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- lethal multiple pterygium syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000540.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | NM_000540.3 | MANE Select | c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG | p.Ser2099_Val2117dup | conservative_inframe_insertion | Exon 39 of 106 | NP_000531.2 | ||
| RYR1 | NM_001042723.2 | c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG | p.Ser2099_Val2117dup | conservative_inframe_insertion | Exon 39 of 105 | NP_001036188.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | ENST00000359596.8 | TSL:5 MANE Select | c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG | p.Ser2099_Val2117dup | conservative_inframe_insertion | Exon 39 of 106 | ENSP00000352608.2 | ||
| RYR1 | ENST00000355481.8 | TSL:1 | c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG | p.Ser2099_Val2117dup | conservative_inframe_insertion | Exon 39 of 105 | ENSP00000347667.3 | ||
| RYR1 | ENST00000594335.6 | TSL:1 | n.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG | non_coding_transcript_exon | Exon 39 of 103 | ENSP00000470927.2 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome AF: 0.00000274 AC: 4AN: 1459160Hom.: 0 Cov.: 32 AF XY: 0.00000138 AC XY: 1AN XY: 725900 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at