chr19-54128903-CAGGCCTCAGCCGGGCCGAGTGGGTACCGGAGCAGGTGCCCGTGGGACCGGCCGGCTGGTGACCGCTGGGCTTCGGGCTGGTGGAGGGGGTGCCTCGGTGGCTGGAGGGCAGGGCCTGGTCGCTGAACTGCAGGGCGCCTCCTCTCCCCCCTAGATCGAGGAGGACGCCTACCAGGAGGACCTGGGATTCAGCCTGGGCCACCT-C
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_015629.4(PRPF31):c.1147-153_1196del(p.Ile383fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. I383I) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_015629.4 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- PRPF31-related retinopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- retinitis pigmentosa 11Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- retinitis pigmentosaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_015629.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PRPF31 | TSL:1 MANE Select | c.1147-153_1196del | p.Ile383fs | frameshift splice_acceptor splice_region intron | Exon 12 of 14 | ENSP00000324122.4 | Q8WWY3-1 | ||
| PRPF31 | c.1246-153_1295del | p.Ile416fs | frameshift splice_acceptor splice_region intron | Exon 13 of 15 | ENSP00000621382.1 | ||||
| PRPF31 | c.1240-153_1289del | p.Ile414fs | frameshift splice_acceptor splice_region intron | Exon 13 of 15 | ENSP00000531481.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at