chr2-176093052-GGGGCGGGCGGCGGCGGCGGCA-G
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000523.4(HOXD13):c.164_184delGGCGGGCGGCGGCGGCGGCAG(p.Gly55_Ala61del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).
Frequency
Consequence
NM_000523.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- brachydactyly-syndactyly syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, G2P
- synpolydactyly type 1Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
- brachydactyly type EInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- syndactyly type 5Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000523.4. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.