chr2-178609768-G-GGTACTCTTTCCCCTCTTCAAGTCCTTTTGCT

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_001267550.2(TTN):​c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC​(p.Gln17219SerfsTer5) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

TTN
NM_001267550.2 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, multiple submitters, no conflicts P:4

Conservation

PhyloP100: 2.97

Publications

0 publications found
Variant links:
Genes affected
TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]
TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 2-178609768-G-GGTACTCTTTCCCCTCTTCAAGTCCTTTTGCT is Pathogenic according to our data. Variant chr2-178609768-G-GGTACTCTTTCCCCTCTTCAAGTCCTTTTGCT is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 466635.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected
GeneTranscriptTagsHGVScHGVSpEffectExon RankProteinUniProt
TTN
NM_001267550.2
MANE Select
c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTACp.Gln17219SerfsTer5
frameshift stop_gained
Exon 272 of 363NP_001254479.2
TTN
NM_001256850.1
c.46701_46731dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTACp.Gln15578SerfsTer5
frameshift stop_gained
Exon 222 of 313NP_001243779.1
TTN
NM_133378.4
c.43920_43950dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTACp.Gln14651SerfsTer5
frameshift stop_gained
Exon 221 of 312NP_596869.4

Ensembl Transcripts

Selected
GeneTranscriptTagsHGVScHGVSpEffectExon RankProteinUniProt
TTN
ENST00000589042.5
TSL:5 MANE Select
c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTACp.Gln17219SerfsTer5
frameshift stop_gained
Exon 272 of 363ENSP00000467141.1
TTN
ENST00000446966.2
TSL:1
c.51468_51498dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTACp.Gln17167SerfsTer5
frameshift stop_gained
Exon 270 of 361ENSP00000408004.2
TTN
ENST00000436599.2
TSL:1
c.51348_51378dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTACp.Gln17127SerfsTer5
frameshift stop_gained
Exon 270 of 361ENSP00000405517.2

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
Mar 26, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

ClinVar contains an entry for this variant (Variation ID: 466635). This sequence change creates a premature translational stop signal (p.Gln17219Serfs*5) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TTN-related conditions. This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic.

Dilated cardiomyopathy 1G Pathogenic:1
Apr 06, 2023
Genomic Medicine Lab, University of California San Francisco
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

not provided Pathogenic:1
Jan 10, 2020
GeneDx
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Has not been previously published as pathogenic or benign to our knowledge; Reported in ClinVar as a likely pathogenic variant (ClinVar Variant ID# 466635; Landrum et al., 2016); Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Located in the A-band region of titin, where the majority of truncating pathogenic variants associated with DCM have been reported (Herman et al., 2012)

Cardiovascular phenotype Pathogenic:1
Apr 13, 2020
Ambry Genetics
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.24429_24459dup31 variant, located in coding exon 99 of the TTN gene, results from a duplication of AGCAAAAGGACTTGAAGAGGGGAAAGAGTAC at nucleotide position 24429, causing a translational frameshift with a predicted alternate stop codon (p.Q8154Sfs*5). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). As such, this alteration is classified as likely pathogenic.

Computational scores

Source: dbNSFP v4.9

Name
Calibrated prediction
Score
Prediction
PhyloP100
3.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1553692107; hg19: chr2-179474495; API