chr2-178609768-G-GGTACTCTTTCCCCTCTTCAAGTCCTTTTGCT
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001267550.2(TTN):c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC(p.Gln17219SerfsTer5) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001267550.2 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TTN | NM_001267550.2 | MANE Select | c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC | p.Gln17219SerfsTer5 | frameshift stop_gained | Exon 272 of 363 | NP_001254479.2 | ||
| TTN | NM_001256850.1 | c.46701_46731dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC | p.Gln15578SerfsTer5 | frameshift stop_gained | Exon 222 of 313 | NP_001243779.1 | |||
| TTN | NM_133378.4 | c.43920_43950dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC | p.Gln14651SerfsTer5 | frameshift stop_gained | Exon 221 of 312 | NP_596869.4 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TTN | ENST00000589042.5 | TSL:5 MANE Select | c.51624_51654dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC | p.Gln17219SerfsTer5 | frameshift stop_gained | Exon 272 of 363 | ENSP00000467141.1 | ||
| TTN | ENST00000446966.2 | TSL:1 | c.51468_51498dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC | p.Gln17167SerfsTer5 | frameshift stop_gained | Exon 270 of 361 | ENSP00000408004.2 | ||
| TTN | ENST00000436599.2 | TSL:1 | c.51348_51378dupAGCAAAAGGACTTGAAGAGGGGAAAGAGTAC | p.Gln17127SerfsTer5 | frameshift stop_gained | Exon 270 of 361 | ENSP00000405517.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
ClinVar contains an entry for this variant (Variation ID: 466635). This sequence change creates a premature translational stop signal (p.Gln17219Serfs*5) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TTN-related conditions. This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic.
Dilated cardiomyopathy 1G Pathogenic:1
not provided Pathogenic:1
Has not been previously published as pathogenic or benign to our knowledge; Reported in ClinVar as a likely pathogenic variant (ClinVar Variant ID# 466635; Landrum et al., 2016); Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Located in the A-band region of titin, where the majority of truncating pathogenic variants associated with DCM have been reported (Herman et al., 2012)
Cardiovascular phenotype Pathogenic:1
The c.24429_24459dup31 variant, located in coding exon 99 of the TTN gene, results from a duplication of AGCAAAAGGACTTGAAGAGGGGAAAGAGTAC at nucleotide position 24429, causing a translational frameshift with a predicted alternate stop codon (p.Q8154Sfs*5). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). As such, this alteration is classified as likely pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at