chr2-227094121-TTACCACTTGATCCTGGGAGGCCCTGCAGGCCTGGTGCTCCAGGCAAGCCAGG-T
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000092.5(COL4A4):c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA(p.Pro441fs) variant causes a frameshift, splice donor, splice region, intron change. The variant allele was found at a frequency of 0.00000205 in 1,461,082 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P441P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000092.5 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive Alport syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, G2P, Orphanet, Ambry Genetics, Myriad Women’s Health
- Alport syndromeInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- hematuria, benign familial, 1Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- autosomal dominant Alport syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| COL4A4 | ENST00000396625.5 | c.1321_1369+3delCCTGGCTTGCCTGGAGCACCAGGCCTGCAGGGCCTCCCAGGATCAAGTGGTA | p.Pro441fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 20 of 48 | 5 | NM_000092.5 | ENSP00000379866.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.00000205 AC: 3AN: 1461082Hom.: 0 AF XY: 0.00000275 AC XY: 2AN XY: 726896 show subpopulations
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Autosomal recessive Alport syndrome Pathogenic:2
- -
- -
Autosomal dominant Alport syndrome Pathogenic:2
- -
- -
Autosomal recessive Alport syndrome;CN376803:Hematuria, benign familial, 1 Pathogenic:1
- -
not provided Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 242441). This variant has been observed in individual(s) with Alport syndrome (Invitae). It has also been observed to segregate with disease in related individuals. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 20 (c.1321_1369+3del) of the COL4A4 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in COL4A4 are known to be pathogenic (PMID: 21196518, 24854265, 25307543). -
Alport syndrome Pathogenic:1
Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease for this gene and is associated with Alport syndrome (MONDO:0018965). Dominant negative is a suspected mechanism of disease for this gene as it is a structural protein (PMIDs: 12028435, 24046192). (I) 0108 - This gene is associated with both recessive and dominant disease. Alport syndrome typically has biallelic inheritance, although rare cases of monoallelic inheritance have been reported (PMID: 28704582). Thin basement membrane nephropathy (TBMN) and focal segmental glomerulosclerosis (FSGS) are associated with autosomal dominant inheritance (OMIM, PMIDs: 16467446, 17942953). (I) 0211 - Canonical splice site variant without proven consequence on splicing (no functional evidence available). This variant is a deletion of 52bp that encompasses part of exon 20 and the cannonical donor splice site of intron 20. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant has been observed in over five unrelated individuals, including in one heterozygous individual with TBMN and her two compound heterozygous affected children (PMIDs: 33233744, 26934356). (SP) 1007 - No published functional evidence has been identified for this variant. (I) 1206 - This variant has been shown to be paternally inherited. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -
Benign familial hematuria Pathogenic:1
PVS1, PM2, PP4, PP5 -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at