chr2-29920362-T-TGAGCAGCGGGGCGCAGTCCAGAGCTAGC
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_004304.5(ALK):c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC(p.Arg100fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 33)
Consequence
ALK
NM_004304.5 frameshift
NM_004304.5 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: -0.942
Genes affected
ALK (HGNC:427): (ALK receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 2 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ALK | NM_004304.5 | c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC | p.Arg100fs | frameshift_variant | 1/29 | ENST00000389048.8 | NP_004295.2 | |
ALK | XR_001738688.3 | n.1197_1224dupGCTAGCTCTGGACTGCGCCCCGCTGCTC | non_coding_transcript_exon_variant | 1/18 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ALK | ENST00000389048.8 | c.270_297dupGCTAGCTCTGGACTGCGCCCCGCTGCTC | p.Arg100fs | frameshift_variant | 1/29 | 1 | NM_004304.5 | ENSP00000373700.3 | ||
ENSG00000288553 | ENST00000669284.1 | n.157+34859_157+34886dupGCTAGCTCTGGACTGCGCCCCGCTGCTC | intron_variant |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
GnomAD4 exome Cov.: 31
GnomAD4 exome
Cov.:
31
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Neuroblastoma, susceptibility to, 3 Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jun 21, 2017 | This sequence change creates a premature translational stop signal (p.Arg100Alafs*135) in the ALK gene. It is expected to result in an absent or disrupted protein product. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with ALK-related disease. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in ALK cause disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at