chr2-47429672-ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT-A
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000251.3(MSH2):c.1077-66_1146del(p.Arg359fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R359R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000251.3 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000251.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | NM_000251.3 | MANE Select | c.1077-66_1146del | p.Arg359fs | frameshift splice_acceptor splice_region intron | Exon 7 of 16 | NP_000242.1 | ||
| MSH2 | NM_001406658.1 | c.-280-66_-211del | splice_region | Exon 7 of 16 | NP_001393587.1 | ||||
| MSH2 | NM_001406659.1 | c.-280-66_-211del | splice_region | Exon 8 of 17 | NP_001393588.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | ENST00000233146.7 | TSL:1 MANE Select | c.1077-69_1143del | p.Arg359fs | frameshift splice_acceptor splice_region intron | Exon 7 of 16 | ENSP00000233146.2 | ||
| MSH2 | ENST00000406134.5 | TSL:1 | c.1077-69_1143del | p.Arg359fs | frameshift splice_acceptor splice_region intron | Exon 7 of 16 | ENSP00000384199.1 | ||
| MSH2 | ENST00000645506.1 | c.1077-69_1143del | p.Arg359fs | frameshift splice_acceptor splice_region intron | Exon 7 of 17 | ENSP00000495455.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at