chr2-47429739-CAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTTCGTCGATTCCCAGATCTTAACCGACTTGCCAAGAAGTTTCAAAGACAAGCAGCAAACTTACAAGATTGTTACCGACTCTATCAGGGTATAAATCAACTACCTAATGTTATACAGGCTCTGGAAAAACATGA-C
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PP3PP5_Very_Strong
The NM_000251.3(MSH2):c.1077_1276del variant causes a exon loss, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_000251.3 exon_loss, splice_region
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MSH2 | NM_000251.3 | c.1077_1276del | exon_loss_variant, splice_region_variant | Exon 7 of 16 | ENST00000233146.7 | NP_000242.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MSH2 | ENST00000233146.7 | c.1077-2_1274del | p.Leu360_Glu425del | splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | Exon 7 of 16 | 1 | NM_000251.3 | ENSP00000233146.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Lynch syndrome Pathogenic:1
- -
not provided Pathogenic:1
The variant results in the deletion of at least one complete exon, and is therefore predicted to result in the loss of a functional protein. Found in at least one patient with expected phenotype for this gene, and not found in general population data. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at