chr2-47799084-T-TGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000179.3(MSH6):c.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC(p.His388ArgfsTer7) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. H388H) has been classified as Benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000179.3 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- intellectual developmental disorder with dysmorphic facies and behavioral abnormalitiesInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | NM_000179.3 | MANE Select | c.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC | p.His388ArgfsTer7 | frameshift stop_gained | Exon 4 of 10 | NP_000170.1 | ||
| MSH6 | NM_001406795.1 | c.1198_1258dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC | p.His420ArgfsTer7 | frameshift stop_gained | Exon 5 of 11 | NP_001393724.1 | |||
| MSH6 | NM_001406813.1 | c.1108_1168dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC | p.His390ArgfsTer7 | frameshift stop_gained | Exon 4 of 10 | NP_001393742.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | ENST00000234420.11 | TSL:1 MANE Select | c.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC | p.His388ArgfsTer7 | frameshift stop_gained | Exon 4 of 10 | ENSP00000234420.5 | ||
| MSH6 | ENST00000445503.5 | TSL:1 | n.*449_*509dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC | non_coding_transcript_exon | Exon 3 of 9 | ENSP00000405294.1 | |||
| MSH6 | ENST00000445503.5 | TSL:1 | n.*449_*509dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC | 3_prime_UTR | Exon 3 of 9 | ENSP00000405294.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 34
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Lynch syndrome 5 Pathogenic:1
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
ClinVar contains an entry for this variant (Variation ID: 525833). This sequence change creates a premature translational stop signal (p.His388Argfs*7) in the MSH6 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MSH6 are known to be pathogenic (PMID: 18269114, 24362816). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. For these reasons, this variant has been classified as Pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at