chr2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A
Variant summary
Our verdict is Pathogenic. Variant got 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000179.3(MSH6):c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC(p.Ala1127_Gln1146del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. Variant has been reported in ClinVar as Pathogenic (★★★).
Frequency
Genomes: 𝑓 0.0000066 ( 0 hom., cov: 32)
Failed GnomAD Quality Control
Consequence
MSH6
NM_000179.3 splice_donor, conservative_inframe_deletion, splice_region, intron
NM_000179.3 splice_donor, conservative_inframe_deletion, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.97
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 16 ACMG points.
PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PP5
Variant 2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A is Pathogenic according to our data. Variant chr2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A is described in ClinVar as [Pathogenic]. Clinvar id is 89377.Status of the report is reviewed_by_expert_panel, 3 stars. Variant chr2-47803625-AGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC-A is described in Lovd as [Pathogenic].
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MSH6 | NM_000179.3 | c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC | p.Ala1127_Gln1146del | splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | 5/10 | ENST00000234420.11 | NP_000170.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MSH6 | ENST00000234420.11 | c.3379_3438+5delGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAGTCTACGCTTATGAGACAGGTAAC | p.Ala1127_Gln1146del | splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | 5/10 | 1 | NM_000179.3 | ENSP00000234420.5 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152168Hom.: 0 Cov.: 32
GnomAD3 genomes
AF:
AC:
1
AN:
152168
Hom.:
Cov.:
32
Gnomad AFR
AF:
Gnomad AMI
AF:
Gnomad AMR
AF:
Gnomad ASJ
AF:
Gnomad EAS
AF:
Gnomad SAS
AF:
Gnomad FIN
AF:
Gnomad MID
AF:
Gnomad NFE
AF:
Gnomad OTH
AF:
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000657 AC: 1AN: 152168Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74340
GnomAD4 genome
Data not reliable, filtered out with message: AS_VQSR
AF:
AC:
1
AN:
152168
Hom.:
Cov.:
32
AF XY:
AC XY:
0
AN XY:
74340
Gnomad4 AFR
AF:
Gnomad4 AMR
AF:
Gnomad4 ASJ
AF:
Gnomad4 EAS
AF:
Gnomad4 SAS
AF:
Gnomad4 FIN
AF:
Gnomad4 NFE
AF:
Gnomad4 OTH
AF:
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:8
Revision: reviewed by expert panel
LINK: link
Submissions by phenotype
not provided Pathogenic:3
Pathogenic, criteria provided, single submitter | clinical testing | Revvity Omics, Revvity | May 04, 2022 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | GeneDx | Dec 03, 2020 | Canonical splice site variant in a gene for which loss-of-function is a known mechanism of disease; Truncating variants in this gene are considered pathogenic by a well-established clinical consortium and/or database; Observed in an individual with early onset colon cancer demonstrating microsatellite instability and loss of MSH6 protein expression (Steinke 2008); Not observed in large population cohorts (Lek 2016); This variant is associated with the following publications: (PMID: 18301448) - |
Pathogenic, criteria provided, single submitter | clinical testing | Quest Diagnostics Nichols Institute San Juan Capistrano | May 08, 2024 | The MSH6 c.3379_3438+5del (p.Tyr1128_Ala1147del) variant has been reported in the published literature in an individual with Lynch syndrome associated tumor (colon cancer) showing loss of MSH6 protein expression and microsatellite instability (PMID: 18301448 (2008)). This variant was observed to result in abnormal splicing (personal communication with Ambry Genetics related to ClinVar ID: 89377. This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Analysis of this variant using software algorithms for the prediction of the effect of nucleotide changes on splicing yielded predictions that this variant may affect proper MSH6 mRNA splicing. Based on the available information, this variant is classified as pathogenic. - |
Hereditary cancer-predisposing syndrome Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Dec 04, 2023 | The c.3379_3438+5del65 pathogenic mutation results from a deletion of 65 nucleotides between positions 3379 and 3438+5 and involves the canonical splice donor site after coding exon 5 of the MSH6 gene. This variant has been identified in a proband(s) whose Lynch syndrome-associated tumor demonstrated high microsatellite instability and/or loss of MSH6 expression by immunohistochemistry (Ambry internal data; Steinke V et al. Eur. J. Hum. Genet. 2008 May;16(5):587-92). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In silico splice site analysis predicts that this alteration will weaken the native splice donor site. RNA studies have demonstrated that this alteration results in abnormal splicing in the set of samples tested (Ambry internal data). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. - |
Likely pathogenic, criteria provided, single submitter | clinical testing | Color Diagnostics, LLC DBA Color Health | Jun 26, 2019 | - - |
Lynch syndrome 5 Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Myriad Genetics, Inc. | Aug 22, 2023 | This variant is considered pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. - |
Lynch syndrome Pathogenic:1
Pathogenic, reviewed by expert panel | research | International Society for Gastrointestinal Hereditary Tumours (InSiGHT) | Sep 05, 2013 | Coding sequence variation resulting in a stop codon (also interrupts canonical donor splice site) - |
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Mar 09, 2023 | In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Studies have shown that this variant is associated with altered splicing resulting in unknown protein product impact (Invitae). ClinVar contains an entry for this variant (Variation ID: 89377). This variant has been observed in individuals with clinical features of Lynch syndrome (PMID: 18301448; Invitae). This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 5 (c.3379_3438+5del) of the MSH6 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MSH6 are known to be pathogenic (PMID: 18269114, 24362816). - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at