chr2-47806566-G-GCTAATCTCCCAGAGGAAGTTAT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000179.3(MSH6):​c.3917_3938dupCTAATCTCCCAGAGGAAGTTAT​(p.Gln1314fs) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

MSH6
NM_000179.3 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 7.81
Variant links:
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-47806566-G-GCTAATCTCCCAGAGGAAGTTAT is Pathogenic according to our data. Variant chr2-47806566-G-GCTAATCTCCCAGAGGAAGTTAT is described in ClinVar as [Likely_pathogenic]. Clinvar id is 433927.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MSH6NM_000179.3 linkuse as main transcriptc.3917_3938dupCTAATCTCCCAGAGGAAGTTAT p.Gln1314fs frameshift_variant, stop_gained 9/10 ENST00000234420.11 NP_000170.1 P52701-1Q3SWU9

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MSH6ENST00000234420.11 linkuse as main transcriptc.3917_3938dupCTAATCTCCCAGAGGAAGTTAT p.Gln1314fs frameshift_variant, stop_gained 9/101 NM_000179.3 ENSP00000234420.5 P52701-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
35
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Carcinoma of colon Pathogenic:1
Pathogenic, no assertion criteria providedclinical testingDepartment of Pathology and Laboratory Medicine, Sinai Health System-The MSH6 p.Gln1314X variant was not identified in the literature nor was it identified in the dbSNP, Clinvitae database, COSMIC, “Mismatch Repair Genes Variant Database”, “MMR Gene Unclassified Variants Database”, InSiGHT Colon Cancer Gene Variant Database (LOVD), Zhejiang Colon Cancer Database (LOVD), ClinVar database, GeneInsight - COGR database, UMD, NHLBI GO Exome Sequencing Project and the Exome Aggregation Consortium database (August 8, 2016) databases. The variant occurs outside of the splicing consensus sequence and 4 of 5 in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer, HumanSpliceFinder) predict a greater than 10% difference in splicing. However, this information is not predictive enough to assume pathogenicity. The c.3917_3938dup variant is predicted to cause a frameshift, which alters the protein's amino acid sequence and leads to a premature stop codon at position 1314. This alteration is then predicted to result in a truncated or absent protein and loss of function. Loss of function variants of the MSH6 gene are an established mechanism of disease in Lynch syndrome and this is the type of variant expected to cause the disorder. In summary, based on the above information, this variant meets our laboratory’s criteria to be classified as pathogenic. -
Breast and/or ovarian cancer Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingCHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern OntarioJun 08, 2021- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553333584; hg19: chr2-48033705; API