chr2-47806566-G-GCTAATCTCCCAGAGGAAGTTAT
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000179.3(MSH6):c.3917_3938dupCTAATCTCCCAGAGGAAGTTAT(p.Gln1314fs) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000179.3 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 35
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Carcinoma of colon Pathogenic:1
The MSH6 p.Gln1314X variant was not identified in the literature nor was it identified in the dbSNP, Clinvitae database, COSMIC, “Mismatch Repair Genes Variant Database”, “MMR Gene Unclassified Variants Database”, InSiGHT Colon Cancer Gene Variant Database (LOVD), Zhejiang Colon Cancer Database (LOVD), ClinVar database, GeneInsight - COGR database, UMD, NHLBI GO Exome Sequencing Project and the Exome Aggregation Consortium database (August 8, 2016) databases. The variant occurs outside of the splicing consensus sequence and 4 of 5 in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer, HumanSpliceFinder) predict a greater than 10% difference in splicing. However, this information is not predictive enough to assume pathogenicity. The c.3917_3938dup variant is predicted to cause a frameshift, which alters the protein's amino acid sequence and leads to a premature stop codon at position 1314. This alteration is then predicted to result in a truncated or absent protein and loss of function. Loss of function variants of the MSH6 gene are an established mechanism of disease in Lynch syndrome and this is the type of variant expected to cause the disorder. In summary, based on the above information, this variant meets our laboratory’s criteria to be classified as pathogenic. -
Breast and/or ovarian cancer Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at