chr2-47806584-G-GTTATTCAAAAGGGACATAGA
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001406800.1(MSH6):c.3922_3941dupTTATTCAAAAGGGACATAGA(p.Glu1314AspfsTer7) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay. The gene MSH6 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_001406800.1 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- intellectual developmental disorder with dysmorphic facies and behavioral abnormalitiesInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001406800.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | MANE Select | c.3935_3954dupTTATTCAAAAGGGACATAGA | p.Lys1319LeufsTer15 | frameshift | Exon 9 of 10 | NP_000170.1 | P52701-1 | ||
| MSH6 | c.4031_4050dupTTATTCAAAAGGGACATAGA | p.Lys1351LeufsTer15 | frameshift | Exon 10 of 11 | NP_001393724.1 | ||||
| MSH6 | c.3941_3960dupTTATTCAAAAGGGACATAGA | p.Lys1321LeufsTer15 | frameshift | Exon 9 of 10 | NP_001393742.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | TSL:1 MANE Select | c.3935_3954dupTTATTCAAAAGGGACATAGA | p.Lys1319LeufsTer15 | frameshift | Exon 9 of 10 | ENSP00000234420.5 | P52701-1 | ||
| MSH6 | TSL:1 | n.*3282_*3301dupTTATTCAAAAGGGACATAGA | non_coding_transcript_exon | Exon 8 of 9 | ENSP00000405294.1 | F8WAX8 | |||
| MSH6 | TSL:1 | n.*3282_*3301dupTTATTCAAAAGGGACATAGA | 3_prime_UTR | Exon 8 of 9 | ENSP00000405294.1 | F8WAX8 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 35
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at