chr2-47806652-GTAACTAACTAACTATAATGGAATTA-G

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BP6_Very_Strong

The NM_000179.3(MSH6):​c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000168 in 1,607,080 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

Frequency

Genomes: 𝑓 0.0000066 ( 0 hom., cov: 32)
Exomes 𝑓: 0.000018 ( 0 hom. )

Consequence

MSH6
NM_000179.3 intron

Scores

Not classified

Clinical Significance

Likely benign criteria provided, multiple submitters, no conflicts B:5

Conservation

PhyloP100: 1.29

Publications

4 publications found
Variant links:
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
FBXO11 Gene-Disease associations (from GenCC):
  • intellectual developmental disorder with dysmorphic facies and behavioral abnormalities
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Benign. The variant received -8 ACMG points.

BP6
Variant 2-47806652-GTAACTAACTAACTATAATGGAATTA-G is Benign according to our data. Variant chr2-47806652-GTAACTAACTAACTATAATGGAATTA-G is described in ClinVar as Likely_benign. ClinVar VariationId is 237203.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MSH6NM_000179.3 linkc.4001+11_4001+35delAACTATAATGGAATTATAACTAACT intron_variant Intron 9 of 9 ENST00000234420.11 NP_000170.1 P52701-1Q3SWU9
FBXO11NM_001190274.2 linkc.*1441_*1465delTAATTCCATTATAGTTAGTTAGTTA downstream_gene_variant ENST00000403359.8 NP_001177203.1 Q86XK2-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MSH6ENST00000234420.11 linkc.4001+11_4001+35delAACTATAATGGAATTATAACTAACT intron_variant Intron 9 of 9 1 NM_000179.3 ENSP00000234420.5 P52701-1
FBXO11ENST00000403359.8 linkc.*1441_*1465delTAATTCCATTATAGTTAGTTAGTTA downstream_gene_variant 1 NM_001190274.2 ENSP00000384823.4 Q86XK2-1

Frequencies

GnomAD3 genomes
AF:
0.00000658
AC:
1
AN:
151882
Hom.:
0
Cov.:
32
show subpopulations
Gnomad AFR
AF:
0.00
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.0000147
Gnomad OTH
AF:
0.00
GnomAD2 exomes
AF:
0.0000205
AC:
5
AN:
244224
AF XY:
0.0000302
show subpopulations
Gnomad AFR exome
AF:
0.00
Gnomad AMR exome
AF:
0.000117
Gnomad ASJ exome
AF:
0.00
Gnomad EAS exome
AF:
0.0000552
Gnomad FIN exome
AF:
0.00
Gnomad NFE exome
AF:
0.00
Gnomad OTH exome
AF:
0.00
GnomAD4 exome
AF:
0.0000179
AC:
26
AN:
1455198
Hom.:
0
AF XY:
0.0000221
AC XY:
16
AN XY:
724206
show subpopulations
African (AFR)
AF:
0.00
AC:
0
AN:
33378
American (AMR)
AF:
0.0000896
AC:
4
AN:
44650
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
26100
East Asian (EAS)
AF:
0.0000505
AC:
2
AN:
39626
South Asian (SAS)
AF:
0.00
AC:
0
AN:
86094
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
49916
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
5760
European-Non Finnish (NFE)
AF:
0.0000171
AC:
19
AN:
1109432
Other (OTH)
AF:
0.0000166
AC:
1
AN:
60242
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.467
Heterozygous variant carriers
0
2
3
5
6
8
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
AF:
0.00000658
AC:
1
AN:
151882
Hom.:
0
Cov.:
32
AF XY:
0.00
AC XY:
0
AN XY:
74180
show subpopulations
African (AFR)
AF:
0.00
AC:
0
AN:
41318
American (AMR)
AF:
0.00
AC:
0
AN:
15240
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3466
East Asian (EAS)
AF:
0.00
AC:
0
AN:
5198
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4830
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
10550
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
316
European-Non Finnish (NFE)
AF:
0.0000147
AC:
1
AN:
67960
Other (OTH)
AF:
0.00
AC:
0
AN:
2092
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.425
Heterozygous variant carriers
0
0
1
1
2
2
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance
Alfa
AF:
0.00
Hom.:
0
Bravo
AF:
0.0000378

ClinVar

Significance: Likely benign
Submissions summary: Benign:5
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Benign:2
Nov 17, 2015
Color Diagnostics, LLC DBA Color Health
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Apr 07, 2020
Ambry Genetics
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Lynch syndrome Benign:1
Jan 02, 2016
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

not provided Benign:1
Apr 12, 2018
GeneDx
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is associated with the following publications: (PMID: 26483394) -

Hereditary nonpolyposis colorectal neoplasms Benign:1
Jan 23, 2025
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
1.3
Mutation Taster
=79/21
polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs878853743; hg19: chr2-48033791; API